Plenti6.3 v5 dest vector

Sequences corresponding to full-length CHT (NM_021815.4) and LV-AA mutation at residues 531–532 (Ribeiro et al., 2005 (link); Ruggiero et al., 2012 (link)) were codon-optimized for expression in human cell lines and custom-synthesized by GeneArt (LifeTech). Constructs were designed with a N-terminal FLAG epitope (Cuddy et al., 2012 (link)) and cloned into the pLenti6.3/V5 DEST vector which also contained a C-terminal V5 epitope tag (LifeTech). Lentiviral particles were generated (ViraPower, Thermofisher Scientific) and used to transduce HEK-293 cells (Sigma Aldrich). Pools of stable transformants were selected with 8 μg/mL Blasticidin. In addition, SH-SY5Y cells (ATCC) were transduced with a CHT construct tagged with GFP at the C-terminal (Origene, PS100071) or a FAP tag at the N-terminus (Sharp Edge Laboratory). Both stable pools and single clones were expanded. HEK-293 cells were cultured in DMEM High glucose (Gibco # 21969-035) supplemented with 10% FBS and 4 mM Glutamine (Thermofisher Scientific). SH-SY5Y cells were cultured in DMEM:F12 with Glutamine (Gibco # 11320-033) supplemented with 15% FBS and 1x NEAA (Thermofisher Scientific).

Full-length dynAP cDNA (NCBI accession number: NM_173629.1) was cloned into the pLenti6.3/V5-DEST vector (Life Technologies, Carsbad, CA, USA). The pLenti6.3/V5-GW/LacZ vector was used as a control. Production of the virus and infection of mammalian cells to express dynAP or LacZ were performed according to the manufacturer’s protocol. Briefly, lentiviruses were generated in HEK293FT cells by co-transfection of pLenti vectors and ViraPower Lentiviral Packaging Mix (Life Technologies). The supernatants were harvested at 48 hours after transfection and used to infect NIH3T3 and NIH3T3H-Ras cells. Infected cells were selected with 5 μg/ml blasticidin S (Sigma-Aldrich) for half a month. Drug-resistant cells were pooled to rule out clonal artifacts. The following random clones were used in this study: NIH3T3LacZ (as a control), NIH3T3dynAP, NIH3T3H-Ras and NIH3T3H-RasdynAP cells.

The pLenti6.3/V5-DEST vector (Life Technologies, currently Thermo Fisher Scientific, Waltham, MA) has been adopted for conjugation of any ORF with the dimerizing Eos. A single Eos sequence was amplified from pcDNA3-Flag1-td-EosFP vector (MoBiTec Rastatt, Germany) and subcloned behind the attR2 site into the pLenti6.3/V5-DEST using XhoI restriction site giving rise to pLenti6.3-C-EOS-V5-DEST enabling c-terminal fusion with dimeric Eos sequence after LR-recombination reaction, since ptd-EostFP encodes dimeric Eos protein^{42 (link)} due to the T/R substitution of wt Eos. Expression thus causes dimerization of the fusion protein with its other dimeric counterpart. The resulting vector enables C-terminal fusion of protein of interest with respective fluorescent protein. Accordingly, the entry clones (ORFs in pENTR221 vector, Life Technologies/Thermo Fisher) of TFAM (ID IOH42148), and mtSSB (ID IOH63190), were subcloned into our pLenti6.3-C-EOS-V5-DEST vectors using LR-recombination reaction.

To construct a lentiviral vector for mouse transformation-related protein 53 (p53), p53 was amplified from mouse cDNA via PCR. Primers for lentiviral construct transduction were as follows:

m-tp53-SalI acgGTCGACggATGACTGCCATGGAGGAGTC

m-tp53-NotI ATAAGAATGCGGCCGCcagTCAGTCTGAGTCAGG

The PCR product was digested with Sal I and Not I and inserted into the pLenti 6.3/v5-DEST vector (Invitrogen). The inserted fragments were verified by Sanger sequencing. A lentiviral construct containing the scrambled p53 sequence was used as negative control. The lentivirus was produced by co-transfecting 293T cells with the transfer vector and two packaging vectors (psPAX2, pMD2.G). The virus was subsequently purified by ultracentrifugation. 1×10⁵ BMMSCs were plated in 6-well plates and transduced with lentiviral constructs and 5 μg/ml polybrene (Sigma). Experiments were performed in triplicate.

Twenty-nine ORFs of splicing factors were obtained as ORF entry clones. They were then cloned into a pLenti6.3 V5/Dest vector to generate the destination clones by the gateway LR reaction (Invitrogen, USA). The 29 splicing factors were selected based on the rank of the unique peptide reads of Mass Spec and the availability of the clones in our cDNA library^{62 (link),63 (link)}. All plasmid constructs were validated by DNA sequencing. The AKAP8 cDNA were cloned into PCDH-CMV-MCS-EF1-Puro between XbaI and BamHI sites with a Flag-tag fused at the C-terminal and were used in the CD44v8 splicing minigene assay. The AKAP8 cDNA was also cloned into a DOX-inducible plasmid pCW57-GFP-2A-MCS between MluI and BamHI sites and were used for overexpression in LM2 cells in the in vivo metastasis assay. For AKAP8 reexpression in the AKAP8 KD HCT116 cells, three synonymous mutations were introduced to AKAP8 shRNA-1 targeting site (wt: GCCAAGATCAACCAGCGTTTG, mut: GCCAAGATTAATCAACGTTTG), by Q5 Site-Directed Mutagenesis kit (NEB, E0554S). All shRNAs were design using the ranidesigner program at Life Technologies and isoform-specific shRNAs were designed according to the described principles^{64 (link)}. ShRNAs were cloned into pLKO.1 vector. All shRNA sequences were listed in Supplementary Table 1.