The largest database of trusted experimental protocols

Cx31 32rfl

Manufactured by Olympus
Sourced in Japan

The CX31-32RFL is a compact and versatile microscope designed for routine laboratory applications. It features a binocular observation tube and a trinocular observation tube, allowing for both direct observation and photographic documentation. The microscope is equipped with a built-in LED illumination system and a series of objectives to accommodate a range of magnification needs.

Automatically generated - may contain errors

9 protocols using cx31 32rfl

1

Quantifying Cerebral Infarct Volume

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ischemic hemisphere was sectioned, stained with the TUNEL detection kit system, and the cell morphology was observed with a laser scanning confocal microscope (CX31-32RFL, Olympus, Tokyo, Japan). The percentage of the infarct volume was measured using Image J software (ver. 1.61). The percentage of the brain-infarct volume was calculated as infarct volume/total volume × 100%.
+ Open protocol
+ Expand
2

PEG11as Expression Detected by FISH

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cy3-labeled probes were synthesized for FISH, which was used to detect PEG11as expression in cells. Briefly, cells were fixed with 4% formaldehyde for 10 min at room temperature and then prehybridized in 0.5% TritonX-100-PBS at room temperature. The FISH probes were hybridized in a hybridization buffer in the dark at 37°C overnight, the probe sequence was TGGAGTACCCTCGAGTGGAGATGAGGATCCTTCCAATCCGGGCTGCCTTCATGGTGTGGTGCCGCTACCTGGAGAACACCGAGGAGCCCATCATGATCCTTCTCAACACAGAGGATCTAGCCTCTCTGAATAATGACAGGCTCACCGTACTTCTCCCCGGGCATTGGGTCTTCTTCTTCTCACACTTCAATTTTGGTGTTATGGAGATGCCAGCTGAAGGTGAC. Nuclei were counter-stained with 4,6-diamidino-2-phenylindole (DAPI) after multiple washes with saline-sodium citrate (SSC) buffer. PEG11as detected under confocal laser microscopy (CX31-32RFL, Olympus, Tokyo, Japan).
+ Open protocol
+ Expand
3

Immunofluorescence Staining of Brain Sections

Check if the same lab product or an alternative is used in the 5 most similar protocols
The immunofluorescence staining of brain paraffin sections were performed as previously described [25 (link)]. After blocking with 5% bovine serum albumin, the sections were incubated with anti-MRTF-A (1:100, sc-398675, Santa Cruz, CA, USA), rabbit anti-β-amyloid (Cell Signaling Technology, 1:2000) or rabbit anti-LC3B (1: 500, ab48394, Abcam, MA, USA), respectively. Then, the sections were washed with 0.1M PBS and then incubated with the fluorescence-labeled secondary antibodies (goat anti-mouse/rabbit 1:200, ab150113, ab150077, Abcam, MA, USA) for 30 minutes at 37° C, and then washed with PBS. Next, the nuclei were stained with DAPI (5 μg/ml) for 2 minutes, and then analyzed with a laser scanning confocal microscope (CX31-32RFL, Olympus).
+ Open protocol
+ Expand
4

DiI-acLDL and FITC-UEA-I Dual Staining of EOCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cells were the same as in the previous section. We added DiI-acLDL (10 mg/l) to these cells and incubated them at 37°C for 4 h, followed by fixing with 4% paraformaldehyde solution for 10 min. After washing with PBS, we added FITC-UEA-I (10 mg/l) to the samples and incubated them at 37°C for 1 h. Staining results were observed under a fluorescence microscope (Olympus, Japan, CX31-32RFL). DiI-acLDL and FITC-UEA-I double-staining positive cells were EOCs in differentiation phase.
+ Open protocol
+ Expand
5

Immunofluorescence Staining of Rat NgR and Brn3a

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sections were dewaxed and hydrated. Antibodies were diluted by diluent, containing 0.01 mol/L PBS, 0.1% Triton X-100 and 10% normal goat serum. Rabbit anti-rat NgR (1:200) was mixed with mouse anti-rat Brn3a (1:200; Sigma, St. Louis, MO, USA). Sections were incubated with the mixture at room temperature for 2 hours, then at 4°C overnight, followed by PBS washes (10 minutes × 3). Sections were then incubated with a mixture containing Alexa 488-labeled donkey anti-rabbit IgG and Alexa 594-labeled donkey anti-mouse IgG (1:500; Santa Cruz Biotechnology, Dallas, TX, USA) for 4 hours at room temperature, followed by PBS washes (10 minutes × 3). These sections were mounted, observed and photographed with a fluorescence microscope (CX31-32RFL; Olympus, Tokyo, Japan).
+ Open protocol
+ Expand
6

Apoptosis Detection in Brain Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sections of the brain and cultured cells were labeled with the TUNEL Bright Red Apoptosis Detection Kit System (Vazyme Biotech, USA) in accordance with the instructions of the TUNEL kit. The sections were observed by Laser Scanning Confocal Microscope (CX31-32RFL, Olympus, Tokyo, Japan). The apoptotic cells were counted by Image J software (ver. 1.61). The apoptotic ratio was calculated as apoptotic cells / total cells × 100%.
+ Open protocol
+ Expand
7

Fluorescent in Situ Hybridization of lncRNA PEG11as

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cy3-labeled lncRNA PEG11as probes were designed and synthesized by BersinBio (Guangzhou, China). The probe signals were determined with the Fluorescent in Situ Hybridization Kit (RiboBio, Guangzhou, China) in accordance with the manufacturer's guidelines. In brief, the N2a cells grew to 60-70% con uency on the slides and were xed with 4% paraformaldehyde (PFA). Cells were pre-hybridized in 0.5% TritonX-100-PBS at room temperature. Later, the FISH probes were hybridized in a hybridization buffer in the dark at 37 °C overnight. After rinsing with the saline-sodium citrate (SSC) buffer, nuclei were counterstained with 4,6-diamidino-2-phenylindole (DAPI). The images were acquired using a confocal laser microscope (CX31-32RFL, Olympus, Tokyo, Japan).
+ Open protocol
+ Expand
8

Apoptosis Analysis in PFN1 Silenced Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Apoptosis in cells transfected with PFN1 siRNA was examined using Hoechst Staining Kit System (Beyotime, China) following the manufacturer's manual. In brief, the N2a cells were cultured in 24-well plates with 5 × 104 cells per well, then transfected with PFN1 siRNA when the cells were grown to 60-70% con uency. Forty-eight hours after transfection, the cells were treated with OGD 3h / R 24h, and then xed with 4% paraformaldehyde at 4°C for 10 min. Following, the cells were washed with PBS and stained with Hoechst 33258 solution in the dark for 10min. The N2a cells were observed using a Laser Scanning Confocal Microscope (CX31-32RFL, Olympus, Tokyo, Japan). The apoptotic ratio was then, calculated as apoptotic cells / total cells × 100%.
+ Open protocol
+ Expand
9

Immunofluorescence Analysis of Podocyte Response

Check if the same lab product or an alternative is used in the 5 most similar protocols
The removed kidneys were weighed and the cortices were then separated. The left cortices were snapfrozen for Western blotting and real-time PCR analyses, and the right cortices were used for pathological analyses. The renal tissues were fixed in Bouin's solution, embedded in paraffin, cut into 5-mm sections, and stained with periodic acid-Schiff (PAS) and H&E staining. For immunofluorescence analysis, the renal cortex of 1 mm × 1 mm × 1 mm was fixed in 2.5% glutaraldehyde and the remaining kidney tissues were fixed in 4% paraformaldehyde.
The podocytes were stimulated by 25 mmol/Lof glucose for 36h, and fixed in 4°C 4% paraformaldehyde for 20 min and 0.6% Tween-20 for 15min, and then blocked with 5% BSA blocking solution for 20 min at room temperature. The cells were exposed to antibodies against VDR, Nephrin, Podocin, α-SMA, and MMP9 overnight. The cells were washed three times with PBS, and then incubated with the Alexa Fluor 488 goat anti-rabbit IgG (H+L) (green) and the Alexa Fluor 594 donkey anti-mouse IgG (H+L) (red) (Invitrogen Inc., Carlsbad, CA, USA) at 37°C for 1 h. The fluorescence was observed under a fluorescence microscope (Olympus, CX31-32RFL, Japan).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!