Herculase 2 fusion

Manufactured by Agilent Technologies

Sourced in United States

Herculase II Fusion is a high-fidelity DNA polymerase designed for use in a wide range of PCR applications. It offers robust performance and reliable results, making it a versatile choice for researchers.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Herculase II fusion polymerase Herculase II Fusion kit Herculase II Fusion DNA Polymerase Kit Herculase II Fusion Enzyme Kit Herculase II Fusion Enzyme with dNTPs Combo Herculase II Fusion DNA Polymerase Herculase II Fusion Enzyme with dNTPs Combo kit Herculase II Fusion Enzyme Herculase II

11 protocols using herculase 2 fusion

Plasmid Cloning and Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids used
in this study are listed in Supporting Information
Table S3. E. coli DH10B-T1^R strain
was used as host for the cloning and propagation of plasmids with
pBR/pUC- and pSC101-ts origins of replication. In the case of suicide
pGE-plasmid derivatives—harboring the conditional pi-dependent
R6K origin of replication—E. coli strains
BW25141 or CC118-λpir were used (Supporting
Information Table S2). The proofreading DNA polymerase Herculase
II Fusion (Agilent Technologies) was used to amplify DNA fragments
for cloning purposes.^{70 (link)} PCR products longer
than 3 kb were inserted in the pCR-BluntII-TOPO plasmid (Zero Blunt
TOPO PCR Cloning Kit, Life Technologies) prior to the cloning in the
final vector. All plasmid constructs were fully sequenced (Secugen
SL, Madrid, Spain). Details of plasmid constructions and oligonucleotide
primers are described in the Supporting Information and Table S4.

Ruano-Gallego D., Álvarez B, & Fernández L.Á. (2015). Engineering the Controlled Assembly of Filamentous Injectisomes in E. coli K-12 for Protein Translocation into Mammalian Cells. ACS Synthetic Biology, 4(9), 1030-1041.

+ Open protocol

+ Expand

Kinetics of CRISPR-induced Indel Formation

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to experimentally determine the kinetics of indel formation, sgRNAs targeting 3 sites (ACTL6A.5, ASF1B.7 and SMARCD2.1) were individually transduced into Cas9-expressing HepG2 cells, using high titer virus to ensure efficient infection of all cells. Genomic DNA was isolated from infected cells (QIAGEN) for 5 consecutive days and editing of the target sites quantified by Sanger sequencing (Herculase II Fusion, Agilent) and TIDE analysis (https://tide.deskgen.com/) (See Table S7 for primers). To confirm the absence of possible phenotypic consequences induced by gene knock-out after 5 days, which may confound the results, cells infected with an EZH2-targeting sgRNA were analyzed by immunofluorescence to quantify the levels of both EZH2 and its associated mark H3K27me3. Based on these experiments, 5 days post-infection was concluded to be the optimal length for performing all subsequent experiments.

Chakrabarti A.M., Henser-Brownhill T., Monserrat J., Poetsch A.R., Luscombe N.M, & Scaffidi P. (2019). Target-Specific Precision of CRISPR-Mediated Genome Editing. Molecular Cell, 73(4), 699-713.e6.

+ Open protocol

+ Expand

DNA Manipulation in E. coli and S. caniferus

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA manipulation in Escherichia coli and S. caniferus GUA-06-05-006A was carried out according to standard protocols [74 ,77 ]. Polymerase chain reaction (PCR) amplifications were performed by using Herculase II Fusion polymerase (Agilent Technologies, Palo Alto, CA, USA) with a previously reported touchdown PCR procedure [44 (link)]. All primers used in this work are described in Supplementary file 3: Table S1. Genetic manipulations in S. caniferus GUA-06-05-006A were confirmed by colony PCR by using the procedure described in [78 (link)] with the following modifications. Bacterial colonies were suspended in 50 μL of 0.2 M 2-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino] ethanesulfonic acid (TES) buffer, pH 7.5, with 1 μL lysozyme (50 mg/mL) and incubated for 40 min at 30 °C. The mix was centrifuged (10,000× g, 2 min) and the pellet thoroughly suspended in 10 μL dimethyl sulfoxide (DMSO). The resulting suspension (2 μL) was used as PCR template with the indicated primer pairs (Supplementary file 3: Table S1).

García-Salcedo R., Álvarez-Álvarez R., Olano C., Cañedo L., Braña A.F., Méndez C., de la Calle F, & Salas J.A. (2018). Characterization of the Jomthonic Acids Biosynthesis Pathway and Isolation of Novel Analogues in Streptomyces caniferus GUA-06-05-006A. Marine Drugs, 16(8), 259.

+ Open protocol

+ Expand

Molecular Cloning Techniques Detailed

Check if the same lab product or an alternative is used in the 5 most similar protocols

The plasmids employed in this study are listed in Table A of S1 Text. PCRs were performed with the Taq DNA polymerase (Roche, NZyTech) for standard amplifications in screenings or with the proof-reading DNA polymerases Herculase II Fusion (Agilent Technologies) or Vent DNA polymerase (NEB) for cloning purposes. When indicated, DNA was synthesized by GeneArt (Life Technologies). All DNA constructs were confirmed by DNA sequencing (Secugen and Macrogen). Oligonucleotides used in this work were obtained from Sigma and are described in Table C of S1 Text.

Cepeda-Molero M., Berger C.N., Walsham A.D., Ellis S.J., Wemyss-Holden S., Schüller S., Frankel G, & Fernández L.Á. (2017). Attaching and effacing (A/E) lesion formation by enteropathogenic E. coli on human intestinal mucosa is dependent on non-LEE effectors. PLoS Pathogens, 13(10), e1006706.

+ Open protocol

+ Expand

Generation of FGFR3 Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Carboxy-terminal FLAG-tagged FGFR3 constructs were generated from PCR (Herculase II Fusion, Agilent) of cDNA generated by reverse transcription (Superscript III ,Invitrogen) of RNA (Trizol, Invitrogen) extracted from murine B9 cells expressing WT and K650E FGFR3-IIIc. PCR products were then inserted into the mammalian expression vector pCDNA3.1(−)A (Invitrogen). C-terminal-truncated WT and K650E FGFR3 constructs with WT or mutant myristylation sequence were provided by Dr. Daniel Donoghue (University of California, San Diego). Selection for stable cell lines was performed by using G418 (800 μg/ml).

St-Germain J.R., Taylor P., Zhang W., Li Z., Ketela T., Moffat J., Neel B.G., Trudel S, & Moran M.F. (2014). Differential regulation of FGFR3 by PTPN1 and PTPN2. Proteomics, 15(2-3), 419-433.

+ Open protocol

+ Expand

Benchmarking Bioinformatic Analysis Pipeline

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to calibrate and benchmark our bioinformatic analysis pipeline, the KIV-2A and KIV-2B plasmids were accurately quantified using a Qubit 3.0 fluorometer with the Qubit High-Sensitivity Kit (Thermo Fisher Scientific) and mixed at the following ratios: 50:50, 90:10, 95:5, 97.5:2.5, 98.5:1.5, and 99:1 (corresponding to a fractional representation of the KIV-2B plasmid of 50%, 10%, 5%, 2.5%, 1.5%, and 1%, respectively). The type B plasmid always represented the minor component to mimic the in vivo situation, where KIV-2B repeats are rarer than KIV-2A repeats (12 (link)). The mixtures were then used as a template for PCR amplification using three different polymerases: Herculase II Fusion (Agilent Technologies), LongAmp Taq DNA Polymerase (LA; NEB), and the LongRange PCR Kit (LR; QIAGEN) (supplemental Table S1). These products were used as templates for Illumina library preparation (see below). To assess reproducibility, all Herculase libraries were prepared three times, including the PCR amplification, and subjected to ultradeep MiSeq sequencing (complete process replicates). Additionally, in a second experiment, the 50% mixes for all three polymerases were again prepared in duplicates, including the PCR, as well as the 1% mixes of Herculase II and LR.

Coassin S., Schönherr S., Weissensteiner H., Erhart G., Forer L., Losso J.L., Lamina C., Haun M., Utermann G., Paulweber B., Specht G, & Kronenberg F. (2018). A comprehensive map of single-base polymorphisms in the hypervariable LPA kringle IV type 2 copy number variation region. Journal of Lipid Research, 60(1), 186-199.

+ Open protocol

+ Expand

Generation of SORLA 3Fn Minireceptor Constructs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The boundaries between the six SORLA 3Fn domains were determined in-silico using online software including PsiPred (49 (link)), Scratch SSpro (50 (link)), and Yaspin (51 (link)) to predict secondary structures within the amino acid sequence. Subsequently, an alignment of the six SORLA 3Fn domains was generated based on their highly conserved pattern of secondary structures and few conserved amino acids using Clustal Omega software.
The FLAG-tagged 3Fn minireceptor (FLAG-mini) was generated by a single-step PCR reaction (Herculase II Fusion, Agilent) using the primer pair (fwd: 5′-CAGGATCCGACTACAAGGACCACGACGGCGACTACAAGGACCACGACATCGACTACAAGGACGACGACGACAAGGAGTTGACTGTGTACAAAGTACAG-3′ and rev: 5′-GTGAATTCTCAGGCTATCACCATGG-3′) amplifying a human SORL1 fragment downstream of Glu1552 (the predicted beginning of 3Fn cassette) to the final protein stop codon. Additionally, the forward primer adds a sequence encoding a 3× FLAG tag to the 5′ end of the amplicon. The PCR product was cloned into a Psectag2B expression vector (#V90020, Invitrogen) using BamHI and EcoRI restriction enzymes.
The myc-tagged 3Fn minireceptor (mini-myc) was generated similarly using the primer pair (fwd: 5′-CAGGATCCGAGTTGACTGTGTACAAAGvTAC-3′ and rev: 5′-GTGAATvTCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCGGCTATCACCATGGG-3′) adding a myc-tag to the C-terminal end of the minireceptor.

Jensen A.M., Kitago Y., Fazeli E., Vægter C.B., Small S.A., Petsko G.A, & Andersen O.M. (2023). Dimerization of the Alzheimer’s disease pathogenic receptor SORLA regulates its association with retromer. Proceedings of the National Academy of Sciences of the United States of America, 120(4), e2212180120.

+ Open protocol

+ Expand

Reverse Transcription of V. cholerae RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT was performed for 1 h at 55 °C with 5 μg of V. cholerae N16961 total RNA, extracted from culture treated with MMC, using the Superscript III (Invitrogen) and primers described in Additional file 2. Superscript III was necessary due to the operon’s length. A control was performed without the enzyme. PCR was performed on cDNA using the Herculase II fusion (Agilent).

Krin E., Pierlé S.A., Sismeiro O., Jagla B., Dillies M.A., Varet H., Irazoki O., Campoy S., Rouy Z., Cruveiller S., Médigue C., Coppée J.Y, & Mazel D. (2018). Expansion of the SOS regulon of Vibrio cholerae through extensive transcriptome analysis and experimental validation. BMC Genomics, 19, 373.

+ Open protocol

+ Expand

Cloning Lactobacillus reuteri PKL Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 2

Chromosomal DNA of Lactobacillus reuteri strain F275 was obtained from ATCC (ATCC #23272D-5, ATCC, Manassas, Va.). The gene encoding phosphoketolase (PKL) enzyme was amplified using primers CMP34: 5′-taaggaggaataaacATGGCAGTAGATTACGATTCCAAG-3′ (SEQ ID NO:32) and CMP335: 5′-ttctagaaagcttcgttacttaagacccttccaagtccag-3′ (SEQ ID NO:33), 100 ng DNA as template and the polymerase Herculase II Fusion according to the manufacturer (Agilent, Santa Clara, Calif.). After purification, the 2442 bp fragment was assembled into NcoI/EcoRI-digested pTrcHis2B (Invitrogen, Carlsbad, Calif.) using the GENEART seamless cloning kit (Invitrogen, Carlsbad, Calif.) to form plasmid pCMP1029 (SEQ ID NO:16—FIG. 7).

US10113185B2. Utilization of phosphoketolase in the production of mevalonate, isoprenoid precursors, and isoprene (2018-10-30). Danisco US Inc. [US], The Goodyear Tire & Rubber Company [US]. Inventors: Zachary Q. Beck [US], Caroline M. Peres [US], Dmitrii V. Vaviline [US], Andrew C. Eliot [US].

+ Open protocol

+ Expand

Cloning and Expression of Bifidobacterium PKL Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 1

Chromosomal DNA of Bifidobacterium infantis was obtained from ATCC (ATCC #15697D-5, ATCC, Manassas, Va.). The gene encoding phosphoketolase (PKL) enzyme was amplified using primers CMP283: 5′-ctgtatTCATGAcgagtcctgttattggcacc-3′ (SEQ ID NO:30) and CMP284: 5′-ctctatGAATTCTCACTCGTTGTCGCCAGCG-3′ (SEQ ID NO:31), 100 ng DNA as template and the polymerase Herculase II Fusion according to the manufacturer (Agilent, Santa Clara, Calif.). After purification, the 2798 bp fragment was digested with BspHI and EcoRI, and ligated with NcoI/EcoRI-digested pTrcHis2B (Invitrogen, Carlsbad, Calif.) to form plasmid pCMP1090 (SEQ ID NO: 15—FIG. 6).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!