T100 thermal cycler system

Thyroids were gently dissociated and then stored at -80°C. Total ribonucleic acid (RNA) was extracted with TRIzol reagent. The concentrations of RNA were determined by measuring absorbance at 260 nm using a UV5 Nano spectrophotometer (Mettler Tolero, Switzerland). Complementary deoxyribonucleic acid (cDNA) was prepared with a HiScript III RT SuperMix reverse transcriptase kit by a T100 thermal cycler system (Bio-Rad, Hercules, CA, USA). Quantitative reverse transcription polymerase chain reaction was conducted with a Taq Pro universal SYBR qPCR master mix by an ABI 7500 real-time PCR system (Applied Biosystems, Waltham, MA, USA). Rat-specific PCR primers were designed. The sequences were as follows: Il-17a, forward 5’-CTC AAC CGT TCC ACT TCA CC-3’, reverse 5’-CAC TTC TCA GGC TCC CTC TTC-3’; Traf6, forward 5’-CCC AAG AAG AGG AAA GAC-3’, reverse 5’-AGG ATC GTG AGG CGT AT-3’; Erk1, forward 5’-CTG GCA CTG AAG GAG G-3’, reverse 5’-AAC AAG ATG AGG CTA CG; Erk2, forward 5’-CCA GAG TGG CTA TCA AGA AG-3’, reverse 5’-GGA TGT CTC GGA TGC CTA; Tnf-α, forward 5’-CCA CCA CGC TCT TCT GTC T-3’, reverse 5’-GCT ACG GGC TTG TCA CTC G-3’; Gapdh, forward 5’-CTC TGC TCC TCC CTG TTC-3’, reverse 5’-CGA TAC GGC CAA ATC C-3’. Gapdh was used as an endogenous control. The PCR results were expressed as the relative expression ratio of targeted genes and Gapdh.

DNA was extracted from a 0.3‐0.5 cm piece of tail. Samples were incubated in 150 μL solution A (160 mg NaOH, 12 mg EDTA, 200 mL ddH₂O) for 45 minutes at 95°C in a water bath. After denaturation, samples were cooled to room temperature before adding 150 μL solution B (10 mL 1.0 mol/L Tris‐HCl, 240 mL ddH₂O) and mixing. Samples were centrifuged at 13684.32 g for 2 minutes, and the supernatant containing the DNA was transferred to a sterile tube. Samples were stored at −20°C until PCR. A PCR mix containing 12.5 μL 2× Taq PCR master mix, 9 μL ddH₂O and 1 μL of each primer (1 mol/L) [Forward: 5′‐TATGTCGCCACAGCAGATAGCC‐3′; reverse: 5′‐CAGCTGTACTGACATGCCTGTCTG‐3′ (Sangon Biotech)] was added to each well of a PCR plate (total volume 23.5 μL), followed by 1.5 μL DNA. The amplification reaction was carried out using a T100™ Thermal cycler system (Bio‐Rad). DNA was initially denatured for 3 minutes at 94°C, then amplified for 32 cycles: denaturation at 94°C for 30 seconds, annealing at 62°C for 35 seconds and extension at 72°C for 35 seconds, followed by a final extension for 5 minutes at 72°C. Amplified samples were stored at 4°C or at −20°C for long‐term storage. Agarose gel electrophoresis was performed to determine the genotypes. Amplified samples were also sent to Sangon Biotech Co., Ltd. for gene sequencing.

A pEBMulti-neo vector (Wako) was used for the stable expression of UBIAD1 or its mutant variants in MG63 cells. The PCR templates used for the construction of stable expression vectors were pIEx/Bac-1-UBIAD1 and pIEx/Bac-1-UBIAD1 point mutants. 1 μL of template (50 ng/mL) was mixed with 25 μL of 2 × PCR buffer for KOD FX (TOYOBO Company Ltd., Osaka, Japan), 10 μL of 2 mM dNTP (dATP, dGTP, dTTP, dCTP) mixed solution, 1 μL of 1 U/μL KOD FX, 1.5 μL SalI (Takara Bio Inc., Otsu, Japan) and Kozak sequence-anchored sense primer (SalI_hUBIAD1_atg: AAAGTCGACCATGGCGGCCTCTCAGGTCCTG), 1.5 μL NotI-anchored antisense primer (NotI_hUBIAD1_taa: AAGCGGCCGCTTAAATTTTGGGCAGACTGCC) and 10 μL sterilized ultra-pure water. PCR amplification was performed using the T100 thermal cycler system (BioRad). After digestion with SalI and NotI, the insert DNA fragment and pEBMulti-neo vector were obtained by electrophoresis (Cosmo Bio Company Ltd., Tokyo, Japan). The ligation reaction was performed with 4 μL insert DNA fragment and 2 μL pEBMulti-neo vector using Ligation High ver.2 (TOYOBO) to generate pEBMulti-UBIAD1 and pEBMulti-UBIAD1 point mutants.