Penicillin streptomycin glutamine (psg)

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, Japan, United Kingdom, Canada, China, Australia, France, Switzerland, Israel, Macao

Penicillin-streptomycin-glutamine is a commonly used antibiotic and amino acid supplement for cell culture applications. It provides a combination of antibiotics to prevent bacterial contamination and the amino acid glutamine to support cell growth and metabolism.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Penicillin/streptomycin (33948 citations) Streptomycin (24872 citations) Penicillin (24825 citations) Glutamine (2902 citations) Glutamine/penicillin/streptomycin (27 citations) Penicillin-streptomycin-glutamine (PSG; (22 citations) Penicillin-streptomycin-glutamine (PSG; 100×), (2 citations)

754 protocols using penicillin streptomycin glutamine (psg)

Cell Culture Conditions for B-lineage and Transformed Cell Lines

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell lines used in this study were listed in the Supplementary information, Table S2. Parental B-lineaged CH12F3 cell line and isogenic Lig4^−/−^{32 (link)} cell line, parental Abelson virus-transformed (v-Abl) mouse pro-B cell line containing the Eμ-Bcl2 transgene^{43 (link)} have been described previously. CH12F3 and its derived isogenic cells were cultured with RPIM1640 (10-040-CV; Corning), β-Mercaptoethanol (M6250-500ML; Sigma-Aldrich), Penicillin-Streptomycin-Glutamine (10378016; Thermo Fisher Scientific), plus 10% FBS (FCS500; ExCell Bio), and v-Abl cells were cultured with RPIM1640 (10-040-CV, Corning), β-Mercaptoethanol (M6250-500ML; Sigma-Aldrich), Penicillin-Streptomycin-Glutamine (10378016; Thermo Fisher Scientific), Sodium Pyruvate (11360670; Thermo Fisher Scientific), MEM Non-Essential Amino Acids Solution (11140050; Thermo Fisher Scientific), HEPES(15630080; Thermo Fisher Scientific), plus 10% FBS (35-053-CM; Corning). MEF, HEK293T and U2OS cells were cultured with DMEM (10-013-CV, Corning), Penicillin-Streptomycin-Glutamine (10378016; Thermo Fisher Scientific), plus 10% FBS (FSP500, ExCell Bio).
All cell lines are negative for mycoplasma contamination.

Liu X., Liu T., Shang Y., Dai P., Zhang W., Lee B.J., Huang M., Yang D., Wu Q., Liu L.D., Zheng X., Zhou B.O., Dong J., Yeap L.S., Hu J., Xiao T., Zha S., Casellas R., Liu X.S, & Meng F.L. (2020). ERCC6L2 promotes DNA orientation-specific recombination in mammalian cells. Cell Research, 30(9), 732-744.

+ Open protocol

+ Expand

Cultivation of Ovarian Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human epithelial ovarian cancer cells lines (SK-OV-3, A2780, OVCAR3 and HO-8910), human ovarian clear cell carcinoma (ES-2) and a human monocytic cell line (THP-1) were purchased from the Type Culture Collection of Chinese Academy of Sciences and maintained according to their recommendations. SK-OV-3 and ES-2 cells were cultured using McCoy's 5a medium (ThermoFisher Scientific, 16600082) supplemented with 1% HEPES (ThermoFisher Scientific, 15630080), 1% penicillin-streptomycin-glutamine (ThermoFisher Scientific, 10378016) and fetal bovine serum to a final concentration of 10%. OVCAR3 cells were cultured using RPMI-1640 medium (ThermoFisher Scientific, 11875135) supplemented with 1% HEPES, 1% penicillin-streptomycin-glutamine and fetal bovine serum to a final concentration of 20%. A2780, HO-8910 andTHP-1 cells were cultured using RPMI-1640 medium supplemented with 1% HEPES, 1% penicillin-streptomycin-glutamine and fetal bovine serum to a final concentration of 10%. THP-1 cells were differentiated into macrophages by addition of PMA (50 ng/mL, Sigma-Aldrich) and overnight incubation. This was followed by 2 washes with THP-1 cell culturing medium, after which the cells were cultured for over 48h post differentiation prior to other experiments.

Liu R., Wei H., Gao P., Yu H., Wang K., Fu Z., Ju B., Zhao M., Dong S., Li Z., He Y., Huang Y, & Yao Z. (2017). CD47 promotes ovarian cancer progression by inhibiting macrophage phagocytosis. Oncotarget, 8(24), 39021-39032.

+ Open protocol

+ Expand

Culturing and Transfecting Breast Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pam212 cells were grown at 37°C in DMEM (Thermo Fisher Scientific, Waltham, MA, catalog no.11995065) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, catalog no. 26140079), 1X penicillin-streptomycin-glutamine (Thermo Fisher Scientific, catalog no. 10378016), 1X MEM non-essential amino acids solution (Thermo Fisher Scientific, catalog no. 11140050), 1X HEPES (Thermo Fisher Scientific, catalog no. 15630080) and 0.1% 2-Mercaptoethanol (Thermo Fisher Scientific, catalog no. 21985023). PyMt^tg cell line (derived from a primary breast tumor of MMTV-PyMT^tg mouse on a C57BL/6 background) was grown at 37 °C in RPMI Medium 1640 (Thermo Fisher Scientific, catalog no. 11875093) supplemented with 10% fetal bovine serum, 1X penicillin-streptomycin-glutamine and 0.1% 2-Mercaptoethanol. Transfections of LPS (Millipore Sigma, catalog no. L6529) or poly(I:C) (Invivogen, San Diego, CA, catalog no. tlrl-pic) in Pam212 cells were performed using Lipofectamine 2000 (Thermo Fisher Scientific, catalog no. 11668019) according to the manufacturer’s instructions. For gene knock down, Pam212 cells were transfected with siRNA construct using Lipofectamine RNAiMax Transfection reagent (Thermo Fisher Scientific, catalog no. 13778075) according to the manufacturer’s instructions. Specific siRNA constructs are listed in Supplementary Table S2.

Park J.H., Mortaja M., Son H., Azin M., Wang J., Collier M., Mandinova A., Semenov Y., Mino-Kenudson M, & Demehri S. (2023). Statin prevents cancer development in chronic inflammation by blocking interleukin 33 expression. Research Square.

+ Open protocol

+ Expand

Murine Embryonic Stem Cell Culture and Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols

During routine passage and CRISPR editing, murine ESCs were cultured in Serum+LIF media: 15% Hyclone FBS (ThermoFisher), 1x Penicillin/Streptomycin/Glutamine (ThermoFisher), 1x Non-essential amino acids (ThermoFisher), 55μM β–mercaptoethanol (ThermoFisher), 1xPrimocin (Invivogen) and 1000U/mL ESGRO LIF (Millipore) in KnockOut DMEM (ThermoFisher). Cells were passaged with 0.25% Trypsin every three days and cultured on MEFs. Prior to all RNA-seq or ATAC-seq experiments, cells were cultured for at least five passages in 2i+LIF media: 1x N2 supplement, 1xB27 supplement, 1x Penicillin/Streptomycin/Glutamine (ThermoFisher), 1x Non-essential amino acids (ThermoFisher), 55μM β–mercaptoethanol (ThermoFisher), 1xPrimocin (Invivogen), 3μM CHIR99021 (Stemgent), 0.5μM PD0325901 (Stemgent) and 1000U/mL ESGRO LIF (Millipore) in a 50%/50% mixture of DMEM/F12 without HEPES (ThermoFisher) and Neurobasal media (ThermoFisher). Cells passaged in 2i+LIF were passaged every three days with 0.25% trypsin and plated at 50k cells/well onto wells pretreated with poly-L-Ornithine (Sigma) and Laminin.
Murine EpiSCs were a gift from P. Tesar and were cultured in Primed hESC media^{12 (link)}. EpiSCs were passaged with 1xCollagenase Type IV (Life Technologies) every three days.

Pastor W.A., Liu W., Chen D., Ho J., Kim R., Hunt T.J., Lukianchikov A., Liu X., Polo J.M., Jacobsen S.E, & Clark A.T. (2018). TFAP2C regulates transcription in human naive pluripotency by opening enhancers. Nature cell biology, 20(5), 553-564.

+ Open protocol

+ Expand

CAPN2 KO and ACE2 KO Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

MA104 cells (ATCC, CRL-2378.1) were cultured in M199 medium (Thermo Scientific, 11150067) supplemented with 10% fetal bovine serum (Avantor VWR, 89510-186) and 1× Penicillin-Streptomycin-Glutamine (Thermo Scientific, 10378016). CAPN2 KO MA104 cells were cultured in complete M199 medium with the addition of puromycin (10 µg/mL) for selection (single-guide RNA sequence: TGATCCGCATCCGAAATCCC). Primers for genomic DNA PCR and Sanger sequencing are as followed: forward: 5′-AAGTTCAGAGGTGAAGCG-3′, reverse: 5′-GGAAGGTGGGGTACATTT-3′. CAPN2 plasmid was purchased from DNASU (clone ID: HsCD00446380), site-directed mutagenesis primers to construct CRISPR/Cas9 cleavage-resistant CAPN2 are as followed: forward: 5′-CTTCTCCCCAGGGGTTTCGGATACGTATCAGTTTCTGT-3′, reverse: 5′-ACAGAAACTGATACGTATCCGAAACCCCTGGGGAGAAG-3′. Vero E6 cells were cultured in DMEM (Thermo Scientific, 11965118) supplemented with 10% fetal bovine serum (FBS) and 1× Penicillin-Streptomycin-Glutamine. Vero E6 TMPRSS2 cells were cultured in DMEM with the same supplements as Vero E6 cells, with 10% blasticidin. SSC-25 cells were cultured in DMEM/Hams F-12 50/50 (Corning, 10-092-CV) with 10% FBS. SSC-25 ACE2 KO SSC-25 cells were cultured in complete DMEM-F12, selected in 2 µg/mL puromycin (single-guide RNA sequence: GTACTGTAGATGGTGCTCAT), and maintained with 1 µg/mL puromycin.

Zeng Q., Antia A., Casorla-Perez L.A., Puray-Chavez M., Kutluay S.B., Ciorba M.A, & Ding S. (2024). Calpain-2 mediates SARS-CoV-2 entry via regulating ACE2 levels. mBio, 15(3), e02287-23.

+ Open protocol

+ Expand

Cell Culture Protocols for Multiple Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T, HEK293, control HEK293, STT3A^-/- HEK293, STT3B^-/- HEK293, COS-7, NIH/3T3, and RAW 264.7 EROS FLAG-tagged cells were maintained in DMEM medium (21969035, Thermo Fisher) containing 10% FBS (F7524, Sigma-Aldrich) and 100 U/mL of Penicillin-Streptomycin-Glutamine (10378016, Thermo Fisher). PLB985 (ACC 139, DSMZ), PLB-clone 14 (Thomas et al., 2018b (link)), PLB- clone 20 (Thomas et al., 2018b (link)), and PLB985 overexpressing EROS- GFP lentivirus construct were cultured in complete RPMI medium consisting of RPMI 1640 (31870025, Thermo Fisher), 10% FBS (F7524, Sigma-Aldrich), 2 mM GlutaMAX (35050061, Thermo Fisher), 1 mM sodium pyruvate (11360070, Thermo Fisher); 0.5 mg/mL Penicillin-Streptomycin-Glutamine (10378016, Thermo Fisher), and 20 mM HEPES (H3537, Sigma-Aldrich). HEK293-F cells were grown in suspension using FreeStyle medium (Invitrogen). All cell lines were tested and confirmed mycoplasma-free using the protocol for Myco-Alert Mycoplasma Detection Kit (LT07-218, Lonza).

Randzavola L.O., Mortimer P.M., Garside E., Dufficy E.R., Schejtman A., Roumelioti G., Yu L., Pardo M., Spirohn K., Tolley C., Brandt C., Harcourt K., Nichols E., Nahorski M., Woods G., Williamson J.C., Suresh S., Sowerby J.M., Matsumoto M., Santos C.X., Kiar C.S., Mukhopadhyay S., Rae W.M., Dougan G.J., Grainger J., Lehner P.J., Calderwood M.A., Choudhary J., Clare S., Speak A., Santilli G., Bateman A., Smith K.G., Magnani F, & Thomas D.C. (2022). EROS is a selective chaperone regulating the phagocyte NADPH oxidase and purinergic signalling. eLife, 11, e76387.

+ Open protocol

+ Expand

Culturing B16F1 and B16-OVA Melanoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

B16F1 cells were obtained from ATCC and cultured in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific) supplemented with 10% (v v⁻¹) fetal calf serum (FCS) (Capricorn Scientific) and 1% (v v⁻¹) penicillin–streptomycin–glutamine (Thermo Fisher Scientific), while B16-OVA cells^{10 (link),47 (link)} were grown in RPMI-1640 (Thermo Fisher Scientific) supplemented with 10% (v v⁻¹) FCS (PAN-Biotech), 1% (v v⁻¹) penicillin–streptomycin–glutamine (Thermo Fisher Scientific), and 0.4 mg mL⁻¹ G418. Both cell lines were routinely tested for mycoplasma infection.

Rosenbaum M., Gewies A., Pechloff K., Heuser C., Engleitner T., Gehring T., Hartjes L., Krebs S., Krappmann D., Kriegsmann M., Weichert W., Rad R., Kurts C, & Ruland J. (2019). Bcl10-controlled Malt1 paracaspase activity is key for the immune suppressive function of regulatory T cells. Nature Communications, 10, 2352.

+ Open protocol

+ Expand

Cell Line Validation and Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

The MDA-MB-231 (HTB-126), MDA-MB-468 (HTB-132), BT-20 (HTB-19) breast cancer cell lines, the HEK293T cell line, and MCFA10 breast epithelial cell line (CRL-10,317) were obtained from ATCC (Manassa, VA) and cultured in DMEM with 10% FBS (SH30071.03; Cytiva; Marlborough, MA) and penicillin-streptomycin glutamine (10,378,016; ThermoFisher Scientific; Waltham, MA). Cell lines were previously validated by the manufacturer using routine STR profiling and purchased new at the start of the study. SUM-159 cells and LM2 cells were gifts from the lab of Prof. Frank Gertler at MIT. LM2 cells were cultured in DMEM with 10% FBS (SH30071.03; Cytiva; Marlborough, MA) and penicillin-streptomycin glutamine (10,378,016; ThermoFisher Scientific; Waltham, MA) and SUM-159 cells were cultured in F-12 (ThermoFisher Scientific, 11,765,062) with 5% FBS, 1% PSG, 5 µg/ml insulin (ThermoFisher Scientific, 12,585,014), 1 µg/ml hydrocortisone (H0888, Sigma, St. Louis, MO), 20 ng/ml EGF (ThermoFisher Scientific, PHG0311). Cells were passaged regularly when they reached approximately 70% confluency and used between p5 and p15 for all experiments. Cells were routinely checked for the presence of mycoplasma by a PCR based method using a Universal Mycoplasma Detection Kit (30–1012 K; ATCC, Manassas, VA). Only mycoplasma negative cells were used in this study.

Payne S.L., Ram P., Srinivasan D.H., Le T.T., Levin M, & Oudin M.J. (2021). Potassium channel-driven bioelectric signalling regulates metastasis in triple-negative breast cancer. EBioMedicine, 75, 103767.

+ Open protocol

+ Expand

Cell Culture and Reagent Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

LNCaP cells and human embryonic kidney 293T cells were purchased from ATCC (Manassas, VA). C4-2 cells were purchased from UroCorporation. LNCaP and C4-2 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific) and 100 μg/ml penicillin-streptomycin-glutamine (Thermo Fisher Scientific) at 37°C with 5% CO₂. 293T cells were maintained in Dulbecco's modified Eagle's medium (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS) (Invitrogen) and 100 μg/ml penicillin-streptomycin-glutamine (Thermo Fisher Scientific) at 37°C with 5% CO₂. Enzalutamide was kindly provided by Medivation/Astellas (San Francisco, CA). Mibolerone was purchased from Steraloids Inc (Newport, RI). The antibody used for AR ChIP-seq is anti-AR (N-20) from Santa Cruz Biotechnology. The antibodies used for western blot are anti-ERK2 (D-2, Santa Cruz Biotechnology), anti-LUZP2 (ab171165, Abcam) and anti-MARC1 (D-16, Santa Cruz Biotechnology).

Zhao J., Zhao Y., Wang L., Zhang J., Karnes R.J., Kohli M., Wang G, & Huang H. (2016). Alterations of androgen receptor-regulated enhancer RNAs (eRNAs) contribute to enzalutamide resistance in castration-resistant prostate cancer. Oncotarget, 7(25), 38551-38565.

+ Open protocol

+ Expand

Drosophila S2 and HEK 293 Cell Culture

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Drosophila S2 cells (S2- DGRC) were obtained directly from the Drosophila Genomics Resource Center (DGRC) and cultured in Drosophila Schneider’s medium supplemented with 10% of FBS (Omega Scientific) and 1% Penicillin-Streptomycin-Glutamine (Thermo Fisher) at 25°C in a humidified incubator. S2 cells stably expressing the FLAG-Mad transgene (Mad-S2) cells were generated by co-transfecting pBRAcpA-FLAG-Mad (Jensen et al., 2009 (link)) and pCoBlast, and then followed by selection with 12.5 μg/mL blasticidin. HEK 293 cells were obtained directly from ATCC and cultured in Dulbecco’s Minimal Essential Medium with 10% FBS (Omega Scientific) and 1% Penicillin-Streptomycin-Glutamine (Thermo Fisher) at 37°C in a humidified incubator with 5% CO₂. Transfection was performed with FuGENE 6 transfection reagent (Promega). All the cell lines were regularly confirmed to be free of contamination (e.g., mycoplasma) through PCR-based tests as recommended by the NIH.

Yang S., Wu X., Daoutidou E.I., Zhang Y., Shimell M., Chuang K.H., Peterson A.J., O'Connor M.B, & Zheng X. (2022). The NDNF-like factor Nord is a Hedgehog-induced extracellular BMP modulator that regulates Drosophila wing patterning and growth. eLife, 11, e73357.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!