Basemuncher endonuclease

Pseudoviruses containing SARS-CoV-2 variant S protein and the backbone of deficient vesicular stomatitis virus (VSV) vector (VSV-ΔG-GFP) (BrainVTA) were generated using the previously described protocols^{47 (link),48} . In brief, 30 μg of S plasmid with a C terminal 18 amino acids truncation was transfected into HEK293T cells cultured in a 10 cm dish, then after 24 h the VSV-ΔG-GFP pseudoviruses were added into the cell supernatant. The inoculum was then removed following incubation at 37 °C for 2 h and the cells were washed with PBS and cultured in DMEM supplemented with both 10% FBS and anti-VSV-G antibody (produced by I1Hybridoma ATCC^® CRL2700™). Then 20 h post-infection, the supernatants were harvested, filtered (0.45 μm filter, Millipore, Cat#SLHP033RB), aliquoted, and stored at −80 °C.
Prior to quantification, the unpackaged RNA in the SARS-CoV-2 pseudoviruses was removed using a 0.5 U/μL BaseMuncher endonuclease (Abcam) treatment at 37 °C for 1.5 h. Viral RNA was extracted using an RNA extraction kit (Bioer Technology) and quantified using a quantitative RT-PCR assay performed using a 7500 Fast Real-Time PCR system (Applied Biosystems). The primers and probe used to detect the L gene of the VSV virus are as described in the literature^{49 (link)}: VSV-F: TGATACAGTACAATTATTTTGGGAC; VSV-R: GAGACTTTCTGTTACGGGATCTGG; VSV-probe: FAM-ATGATGCATGATCCWGC-TAMRA.

Algae cultures were grown in a semi-continuous fashion in 1 L baffled flasks in TAP media wherein 95% of the culture was harvested via centrifuge and replaced with new media every two days; harvested call pellets were snap frozen until lysis. Cells were lysed in 1X Bugbuster (diluted from 10X buffer free stock) buffered with 50 mM Tris-HCl pH8.5 containing 1X Pierce Protease Inhibitor Cocktail (Cat#A32955; Thermo Scientific, Waltham, MA), 250 U/mL of Basemuncher endonuclease (ab270049, Abcam, Cambridge, MA), 1 mM DTT, 1 mM EDTA. 10 mL of lysis buffer was added to each gram of snap frozen wet biomass with typically 3–6 grams of wet biomass being processed at once. To the partially clarified cell lysate 10% wt/vol Polyethylenimine (Cat#408719, Sigma-Aldrich, St. Louis, MO), adjusted to pH 8.5 by addition of concentrated HCl was added to a final concentration 0.1% wt/vol. The lysate was then centrifuged at 6000 rcf at 4°C for 5 minutes and supernatant recovered. The lysate was then further decolorized by gently shaking against an equal volume of Methyl tert-Butyl Ether (MTBE) twice and then Hexanes (Fisher Scientific). The aqueous layer was then recovered, filtered through a 0.45 μm PES syringe filter and applied to a Capto Q anion exchange resin for column chromatography purification on an Akta pure 150 system fitted with an external sample pump (Cytiva, Amersham, UK).

To obtain SARS-CoV-2 PT and variants pseudoviruses, we constructed replication-deficient vesicular stomatitis virus vector backbone (VSV-ΔG-GFP) expressing the corresponding spike proteins. 30 mg of spike protein expression plasmids were transfected into HEK293T cells each 10 cm culture dish. After 24 h, The VSV-ΔG-GFP pseudoviruses were added to the transfected cell supernatant. After incubation for 2 h at 37 °C, inoculum was replaced with fresh DMEM containing both 10% FBS and anti-VSV-G antibody produced by I1HybridomaATCC®-CRL2700™. The pseudovirues were obtained 30 h post-infection. After being filtered by 0.45 mm filters (Millipore, Cat#SLHP033RB), the pseudoviruses were aliquoted and stored at −80 °C.
0.5 U/mL BaseMuncher endonuclease (Abcam) was used to remove unpackaged RNA at 37 °C for 1 h. Viral RNA was extracted using an RNA extraction kit (Bioer Technology) and quantified by quantitative RT-PCR.

For His6-tagged proteins, 500-mL cultures of E. coli containing the relevant expression plasmid were induced at mid-exponential growth phase with 0.2 mM IPTG (isopropyl-β-d-thiogalactopyranoside) overnight at 20°C (94 (link)). Concentrated cells were lysed in 20 mL binding buffer (0.5 M NaCl, 75 mM Tris; pH 7.75) plus 0.2 mg mL⁻¹ lysozyme (Avantor-VWR, Radnor, PA) and 500 U Basemuncher endonuclease (Abcam, Cambridge, UK) for 30 min on ice and then sonicated. Cleared supernatant was applied to a 5-mL HisTrap FF crude column (Cytiva, Marlborough, MA), and the bound, His-tagged protein was eluted with 125 mM imidazole. Eluted protein was desalted on a HiPrep 26/10 desalting column (Cytiva) and then further separated by size exclusion chromatography on a HiLoad 16/60 Superdex 200 preparative-grade gel filtration column. All chromatography steps were carried out on an AKTA Prime instrument (Cytiva). Purified proteins were concentrated in a Spin-X UF centrifugal concentrator (Corning Inc., Corning, NY) and quantified by the extinction coefficient method and a NanoDrop 1000 Spectrophotometer (Thermo Scientific, Waltham, MA). Samples were stored at −80°C in binding buffer plus 50% glycerol.

The protocols of a replication-deficient vesicular stomatitis virus (VSV) vector backbone (VSV-ΔG-GFP) was used to obtain pseudoviruses of SARS-CoV-2 sub-variants^{58 (link)}. The plasmids containing genes of representative full-length spike proteins were transfected into HEK293T cells. The VSV-ΔG-GFP pseudoviruses were added to the cell plates 24 h later, and then the inoculum was removed after incubation for 1 h at 37 °C. After being washed with PBS, the cells were cultured in DMEM containing 10% FBS and anti-VSV-G mouse monoclonal antibody (10 μg/mL) produced by I1-Hybridoma (ATCC, CRL-2700). The pseudoviruses were harvested 30 h post-infection, filtered by 0.45 μm filters (Millipore, SLHP033RB), and stored at −80 °C.
Unpackaged RNA was removed by 0.5 U/μL BaseMuncher endonuclease (Abcam) at 37 °C for 1 h. The viral RNA was then extracted using an RNA extraction kit (Bioer Technology) and quantified by quantitative RT–PCR (qRT-PCR) using a 7500 fast real-time PCR system (Applied Biosystems). The L gene of VSV was quantified by primers and the probe, as previously described^{60 (link)}.

All commercially available chemicals were
used without further purification. BaseMuncher endonuclease was purchased
from Abcam. Ampicillin, dithiothreitol (DTT), and isopropyl-β-D-1-thiogalactopyranoside
(IPTG) were purchased from Formedium. Escherichia coli (E. coli) DH5α (high efficiency)
and BL21(DE3) cells, Gibson Assembly Cloning Kit, and Dpn1 were purchased
from New England Biolabs. QIAprep Spin Miniprep, PCR clean-up, and
Plasmid Midi kits were purchased from Qiagen. Ethylenediaminetetraacetic
acid (EDTA)-free Complete protease inhibitor cocktail was purchased
from Roche. Ammonium bicarbonate, ammonium sulfate, ATP, deuterium
oxide (D₂O), glycerol, histidine, imidazole, lysozyme,
PRPP, potassium chloride, d-ribose 5-phosphate, tricine,
phosphoenolpyruvate, Saccharomyces cerevisiae (S. cerevisiae) pyruvate kinase (ScPK), S. cerevisiae myokinase
(ScMK), NiCl₂, and ZnCl₂ were
purchased from Merck. Agarose, dNTPSs, kanamycin, 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic
acid (HEPES) EnzCheck Pyrophosphate Kit, MgCl₂, NaCl, PageRuler
Plus Prestained protein ladder, and Phusion High-Fidelity polymerase
were purchased from ThermoFisher Scientific. Psychrobacter
arcticus HisG_S (PaHisG_S), M. tuberculosis pyrophosphatase
(MtPPase), and tobacco etch virus protease (TEVP)
were produced as previously described,^{20 (link)} as was E. coli PRPP synthetase (EcPRPPS).^{21 (link)}

All commercially available chemicals were
used without further purification. BaseMuncher endonuclease was purchased
from AbCam. Ampicillin, dithiothreitol (DTT), and isopropyl-β-D-1-thiogalactopyranoside (IPTG) were purchased from Formedium. Escherichia coli DH5α (high efficiency) and
BL21(DE3) cells and Gibson Assembly Cloning Kit were purchased from
New England Biolabs. Ethylenediaminetetraacetic acid (EDTA)-free Complete
protease inhibitor cocktail was purchased from Roche. Deuterium oxide
(D₂O), sodium deuteroxide, 2-(N-morpholino)ethanesulfonic
acid (MES), N-[tris(hydroxymethyl)methyl]-3-aminopropanesulfonic
acid (TAPS), glycerol, imidazole, lysozyme, NiCl₂, tris(hydroxymethyl)aminomethane
(Tris), polyethylene glycol 8000 (PEG-8000), and dUMP were purchased
from Merck. Agarose, dNTPs, 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic
acid (HEPES), NaCl, and Phusion high-fidelity polymerase were purchased
from ThermoFisher Scientific. Tobacco etch virus protease (TEVP) was
produced as previously described.^{11 (link)}