Lentiviral vectors for NME4-shRNA, which were purchased from Shanghai GeneChem Co., Ltd., were used to examine the function of NME4 (human NME4 cDNA; National Center for Biotechnology Information accession no. NM_005009); the vector used was hU6-MCS-CMV-EGFP. A total of two experimental groups for each cell line were constructed. The shNME4 group was infected with NME4-shRNA lentivirus (5′TGATTGGACACACCGACTC3′), while control cells were infected with a lentivirus containing a scramble sequence (5′TTCTCCGAACGTGTCACGT3′). NCI-H1299, A549 and BEAS-2B cells in 6-well plates (2×106 cells/well) were infected with lentiviral particles at a multiplicity of infection of 10 (5×106 TU/ml) for 16 h using polybrene (Sigma-Aldrich; Merck KGaA), following which the medium was replaced with fresh culture medium and cells were cultured for a further 56 h; the knockdown efficiency was detected by RT-qPCR. Prior to transduction, the medium of A549 cells was replaced with Opti-Minimal Essential Medium (Gibco; Thermo Fisher Scientific, Inc.) + polybrene, whereas the H1299 cell medium was replaced with RPMI-1640 medium + polybrene; BEAS-2B cells were cultured with DMEM/F12 + polybrene for transduction.
Polybrene
Manufactured by Thermo Fisher Scientific
Sourced in United States, China, Germany
Polybrene is a cationic polymer used to enhance the efficiency of transfection, the process of introducing nucleic acids into cells. It functions by neutralizing the negative charge on the cell surface, facilitating the binding and uptake of negatively charged nucleic acids, such as DNA and RNA.
Automatically generated - may contain errors
Lab products found in correlation
Puromycin, by Thermo Fisher Scientific (19 mentions)
Puromycin, by Merck Group (12 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (11 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (5 mentions)
Pspax2, by Addgene (5 mentions)
Pmd2 g, by Addgene (5 mentions)
Polybrene, by Merck Group (4 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions)
Opti mem, by Thermo Fisher Scientific (4 mentions)
Blasticidin, by Thermo Fisher Scientific (3 mentions)
Pes filter, by Merck Group (3 mentions)
Lenticrispr v2, by Addgene (3 mentions)
Peg it virus precipitation solution, by System Biosciences (2 mentions)
Lipopolysaccharides (lps), by Merck Group (2 mentions)
Lenti x concentrator kit, by Takara Bio (2 mentions)
Retronectin coated plate, by Takara Bio (2 mentions)
Puromycin, by Santa Cruz Biotechnology (2 mentions)
Sc 108080, by Santa Cruz Biotechnology (2 mentions)
Hepes buffer, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
114 protocols using polybrene
1
Lentiviral Knockdown of NME4 in Lung Cells
2
Lentiviral Transduction and Selection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
K562 cells were seeded at 5 × 105 cells/ml in 2 ml per well in a 6-well plate the day of infection. Cells were infected with virus, and polybrene was added at 1:1000 final volume (Invitrogen). Cells were incubated overnight before being selected with puromycin (2 μg/ml final concentration) (Gibco), geneticin (500 μg/ml) (Gibco), or hygromycin (Gibco) (250 μg/ml) for 48 h.
HepG2 cells were seeded at 6 × 105 cells per well the day before infection in a 6-well plate. Cells were then infected with virus, and polybrene was added at 1:2000 final volume (Invitrogen). Cells were incubated overnight before being selected with puromycin (3 μg/ml final concentration) (Gibco) for 48 h.
HepG2 cells were seeded at 6 × 105 cells per well the day before infection in a 6-well plate. Cells were then infected with virus, and polybrene was added at 1:2000 final volume (Invitrogen). Cells were incubated overnight before being selected with puromycin (3 μg/ml final concentration) (Gibco) for 48 h.
3
Lentiviral Transduction and Selection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus was produced in 293FT packaging cells and collected 48–72 h post-infection. For lentiviral overexpression or knockdown of miR-1246 or miR-1290, cells (tumoursphere, A549, NuLi-1 and HEK293) were infected with the lentiviral supernatant for 48 h in the presence of 8 μg ml−1 polybrene (Sigma). Two days after infection, puromycin was added to the media at 1 μg ml−1, and cell populations were selected for 1–2 weeks. For lentiviral overexpression of MT1G, cells (tumoursphere and HEK293) at 70% confluence were transduced with MT1G lentiviral particles (1.64 × 109 TU ml−1, Open Biosystems) or control lentiviral particles (2 × 108 TU ml−1, Open Biosystems) together with polybrene. Then the infected cells were passaged and selected by blasticidin S (Invitrogen) at 12 μg ml−1 for 1–2 weeks. For inducible lentiviral knockdown of MT1G, tumoursphere cells at 70% confluence were transduced with two shRNAs against MT1G lentiviral particles (Open Biosystems) or control lentiviral particles together with polybrene. Then the infected cells were passaged, induced by 0.5 ug ml−1 doxycycline and then selected by puromycin at 1 μg ml−1 for 1–2 weeks.
4
Lentiviral Production and Transduction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protocol for lentivirus production and transduction have been described elsewhere.35 Briefly, 293T cells were transfected with four µg of plasmid and four µg of the lentiviral vectors using Lipofectamine‐3000 according to the manufacturer's protocol (Invitrogen). PEG‐it virus precipitation solution (SBI System Biosciences) was added to the supernatant, and ultracentrifugation was performed to collect concentrated viral particles. Hepatocytes were transduced with lentiviral particles with 6 μg/ml polybrene (Invitrogen).
5
Modulating METTL3 in Intestinal Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For METTL3 knockdown or overexpression, lentivirus containing specific short hairpin RNA (#1 sh-METTL3 or #2 sh-METTL3, GenePharma, Shanghai, China) or METTL3-overexpressing fragment was transfected into MODE-K cells using polybrene (Invitrogen). 48 h later, the cells were harvested for further investigation. The scramble shRNA was used as a negative control (sh-NC). The sequences were listed in Table S1 .
For LPS stimulation, MODE-K cells were incubated with 200 ng/ml LPS (Sigma-Aldrich, USA) for 48 h.
For NF-κB inhibition, MODE-K cells were incubated with 10 μM JSH-23 (Sigma-Aldrich) for 48 h.
For LPS stimulation, MODE-K cells were incubated with 200 ng/ml LPS (Sigma-Aldrich, USA) for 48 h.
For NF-κB inhibition, MODE-K cells were incubated with 10 μM JSH-23 (Sigma-Aldrich) for 48 h.
6
Overexpression of Tfcp2l1 in mESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mESCs that stably overexpress the Flag‐tagged Tfcp2l1 proteins were established by transfection of the indicated plasmids using Lipofectamine 2000 (Invitrogen), followed by selection under 1 mg/ml G418 Geneticin (Invitrogen) for 2 weeks. For expressing non‐tagged Tfcp2l1 WT or variant proteins, lentivirus containing the corresponding ORFs cloned into the pLEX307 lentiviral vector was produced using a four‐plasmid transfection system (Invitrogen). The recombinant pseudo‐lentiviral particles were concentrated using Lenti‐X Concentrator kit (Clontech, Mountain View, CA), infected into murine ESCs using 6 μg/ml polybrene (Invitrogen), and assays were performed at 4 days after infection.
7
Generating shRNA-mediated RBPJK knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A PLVshRNA-EGFP (2A) Puro vector (VL3103; Beijing Yingmao Shengye Biotechnology Co., Ltd.) was digested by BamHI/EcoRI at 37°C. The shRNA sequences were integrated into the vector according to the protocol: Pre-denaturation at 95°C for 5 min, 84°C for 5 min, 74°C for 5 min and 72°C for 5 min, and then maintenance at 4°C. Lentiviruses encoding shRBPJK were established as previously described (14 (link)). At 60% confluence, cells were transduced with the aforementioned lentiviruses (Shanghai GenePharma Co. Ltd.) encoding shRBPJK (1×106 IFU/PFU/ml) or empty vector (Shanghai GenePharma Co. Ltd.) using Polybrene (Invitrogen; Thermo Fisher Scientific, Inc.). Twenty-four hours after transduction, the medium was replaced with fresh DMEM, and cells were incubated in a CO2 incubator (5% CO2) at 37°C for 48 h. RBP-JK mRNA and protein expression were detected by quantitative real-time PCR and western blotting, respectively.
8
Signaling Pathway Profiling via Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary antibodies against total-p65, phospho-p65 (S536), total-c-Jun, phospho-c-Jun (Ser63/Ser73), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Cell Signaling Technologies (Danvers, MA, U.S.A.). Antibodies against NMBR weres purchased from Sigma–Aldrich (St. Louis, MO, U.S.A.). Antibodies against α-smooth muscle actin (α-SMA) were purchased from Abcam (Cambridge, U.K.). Horseradish peroxidase (HRP)–conjugated anti-rabbit or anti-mouse secondary antibodies were purchased from Cell Signaling Technologies (Danvers, MA, U.S.A.). An ECL-plus kit was purchased from Advansta (MenloPark, CA, U.S.A.). NMB was purchased from Bachem (Bubendorf, Switzerland). The human IL-6 enzyme-linked immunosorbent assay (ELISA) kit was purchased from Enzo Life Sciences (New York, NY, U.S.A.). Polybrene was purchased from Invitrogen (San Diego, CA, U.S.A.).
9
Mesenchymal Stem Cell Culture and Lentivirus Transduction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
M-MSCs differentiated from human H9 ESCs [21 (link)] were maintained in EGM2-MV medium (Lonza, San Diego, CA, USA) on rat tail collagen type I (Sigma-Aldrich, St. Louis, MO, USA)-coated plates in a humidified and heated atmosphere of 5% CO2 and 37 °C as previously described [24 (link),26 (link)]. Human UC-MSCs were cultured in low-glucose DMEM containing 10% heat-inactivated FBS, 5 ng/mL human epidermal growth factor (Sigma-Aldrich, St. Louis, MO, USA), 10 ng/mL basic fibroblast growth factor, and 50 ng/mL long-R3 insulin-like growth factor-1 (ProSpec, Rehovot, Israel) as previously described [27 (link)]. Both M-MSCs and UC-MSCs were positive for the expression of CD29, CD73, and CD105 surface molecules but lacked CD14, CD34, and CD45 hematopoietic lineage marker expression (Supplementary Figure S1 ). All M-MSCs were expanded for less than ten passages to ensure multipotency. To induce stable GFP expression, M-MSCs were infected with a GFP-expressing lentivirus, which was generated as described previously [28 (link),29 (link)]. M-MSCs were infected with concentrated lentivirus containing a GFP expression construct using 6 µg/mL polybrene (Invitrogen, Carlsbad, CA, USA), and infected cells were selected using 6 µg/mL blasticidin (Invitrogen).
10
Modulating ERα36 Expression in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For stable ERα36 overexpression or knockdown, lentivirus-expressing ERα36 (GenBank Accession No. BX640939) or ERα36-specific shRNAs19 (link),25 (link) were packaged by transfection of HEK293 cells. After 48 h, viruses were harvested and filtered through 0.45 μm filters. Viral titers were determined by using infected 3T3 cells. MOI 5 to 10 were used depending on individual cell lines. Lentivirus and 8 μg/mL polybrene (Invitrogen) were added to the culture of breast cancer cells and incubated overnight at 37 °C in a humidified atmosphere with 5% CO2. Gene transduction efficiency was determined by FACS analysis GFP. To eliminate the off-target effects, two shRNAs were designed to target different 3′ UTR region of ERα36. The following shRNAs were used:
Scrambled shRNA: TTCTCCGAACGTGTCACGT
shERα36-1: GCAATTATTCCTTTGCCTTGC;
shERα36-2: GCGTTGCATCATAACATAAGC.
All lentivirus contained GFP-encoding sequences of the infected cells were verified by flow cytometry and immunobloting assays.
Scrambled shRNA: TTCTCCGAACGTGTCACGT
shERα36-1: GCAATTATTCCTTTGCCTTGC;
shERα36-2: GCGTTGCATCATAACATAAGC.
All lentivirus contained GFP-encoding sequences of the infected cells were verified by flow cytometry and immunobloting assays.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!