Fastgene rna premium kit

Manufactured by Nippon Genetics

Sourced in Japan

The FastGene RNA Premium Kit is a lab equipment product designed for the extraction and purification of RNA from various biological samples. It provides a simple and efficient method for isolating high-quality RNA suitable for downstream applications such as reverse transcription and real-time PCR.

Automatically generated - may contain errors

Lab products found in correlation

Steponeplus real time pcr system, by Thermo Fisher Scientific (6 mentions) Kod sybr qpcr mix, by Toyobo (5 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions) Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (3 mentions) Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (3 mentions) Kapa sybr fast qpcr kit, by Roche (3 mentions) Stepone real time pcr system, by Thermo Fisher Scientific (2 mentions) Revertra ace, by Toyobo (2 mentions) Truseq stranded mrna lt sample prep kit, by Illumina (2 mentions) Fastgene gel pcr extraction kit, by Nippon Genetics (2 mentions) Hiscribe t7 high yield rna synthesis kit, by New England Biolabs (2 mentions) E coli poly a polymerase, by New England Biolabs (2 mentions) Cleancap reagent ag, by TriLink (2 mentions) Nanodrop one spectrophotometer, by Thermo Fisher Scientific (2 mentions) N1 methyl pseudo utp, by TriLink (2 mentions) Primescript rt master mix, by Takara Bio (2 mentions) Fastgene scriptase 2, by Nippon Genetics (2 mentions) Thermal cycler dice real time system, by Takara Bio (2 mentions) Novaseq 6000, by Illumina (2 mentions) Nanodrop 2000 ultra micro spectrophotometer, by Thermo Fisher Scientific (2 mentions)

Spelling variants of this product

FastGene RNA Kit (2 citations) RNA Premium Kit (2 citations)

40 protocols using fastgene rna premium kit

Quantifying Immune Cytokine Profiles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from cells treated with CpG-ODN and LPS was purified using the FastGene RNA
Premium Kit (Nippon Genetics Co., Ltd., Tokyo, Japan). cDNA was prepared by reverse
transcription of 100 μg total RNA per sample using SuperScript IV reverse transcriptase
(Thermo Fisher Scientific). Equal volumes of cDNA were used to quantify various immune
response-related cytokine factors by qRT-PCR using the StepOne real-time PCR system
(Applied Biosystems, Foster City, CA, USA) and KOD SYBR qPCR Mix (Toyobo Co., Ltd., Osaka,
Japan) with specific primers. The nucleotide sequences of the primers that were used are
listed in Table 2. qRT-PCR was performed in
duplicate. The relative expression levels of each target gene were calculated using the
ΔΔCt method (Livak and Schmittgen,
2001) and normalized against β-actin expression.

Ichikawa K., Matsuzaki M., Ezaki R., Horiuchi H, & Yamamoto Y. (2023). Screening of Optimal CpG-Oligodeoxynucleotide for Anti-Inflammatory Responses in the Avian Macrophage Cell Line HD11. The Journal of Poultry Science, 60(1), 2023002.

+ Open protocol

+ Expand

Establishment of CCL21-overexpressing B16-F10 melanoma cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mouse melanoma cell line B16‐F10 was obtained from the American Type Culture Collection. Cells were cultured in DMEM (FUJIFILM Wako Pure Chemicals) supplemented with 10% (v/v) fetal calf serum, 2 mM l‐glutamine, 1 mM sodium pyruvate, 100 U/mL penicillin, 100 μg/mL streptomycin, 50 μM 2‐mercaptoethanol, 0.1 mM nonessential amino acids, and 10 mM HEPES (Nacalai Tesque). The cells expressing mouse CCL21‐Ser were established as follows. Total RNA was extracted from a C57BL/6 LNs using FastGene RNA Premium Kit (NIPPON Genetics). After conversion to cDNA using Fast gene Scriptase II cDNA 5× Ready Mix (NIPPON Genetics), the DNA fragment corresponding to the mouse Ccl21a full‐length cDNA was treated with restriction enzymes XhoI (TaKaRa) and NotI (New England Biolabs Japan) and was inserted into the pCAGI‐puro vector (kindly provided by Dr. J. Miyazaki, Osaka University). The plasmid harboring Ccl21a and the pCAGI‐puro vector was transfected into B16‐F10 cells by the PEI‐MAX (Polysciences) according to the manufacturer's instructions and cultured in a culture medium containing 1 μg/mL puromycin to establish drug‐resistant cells.

Miyamoto M., Kawato Y., Fujie R., Kurowarabe K., Fujiwara K., Nobusawa R., Hayashi R., Iida K., Ohigashi I, & Hayasaka H. (2023). CCL21‐Ser expression in melanoma cells recruits CCR7 + naïve T cells to tumor tissues and promotes tumor growth. Cancer Science, 114(9), 3509-3522.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using a FastGene RNA Premium Kit (Nippon Genetics, Tokyo, Japan) and reverse-transcribed into complementary DNA using random primers and ReverTra Ace (Toyobo, Osaka,
Japan). RT-qPCR was performed in triplicate using Taq Pro Universal SYBR qPCR Master Mix (Nanjing Vazyme Biotech, Nanjing, China) and the StepOnePlus Real-Time PCR System (Thermo Fisher
Scientific), according to the manufacturer’s instructions. All primers used are listed in Supplementary Table 3. PCR data were
analyzed using the ∆/∆CT method and normalized to β-ACTIN expression.

KIMURA K., NAGAKURA H., TSUKAMOTO M., YOSHIDA T., SUGISAKI H., SHISHIDA K., TACHI Y., SHIMASAKI S., SUGIURA K, & HATOYA S. (2024). Canine induced pluripotent stem cells can be successfully maintained in weekend-free culture systems. The Journal of Veterinary Medical Science, 86(3), 247-257.

+ Open protocol

+ Expand

Mite DNA and RNA Extraction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mites were homogenized using a mortar and pestle in 200 μL of phosphate-buffered saline, and total cellular DNA was extracted using QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany), according to the manufacturer's instructions. Samples were eluted in 200 μL of elution buffer and stored at -20 °C. For RNA extraction, FastGene RNA Premium Kit (NIPPON Genetics Co. Ltd., Tokyo, Japan) was used. After the chicken mites were homogenized in 350 μL of RL buffer, total cellular RNA was extracted according to the manufacturer's instructions. cDNA was synthesized using PrimeScript^TM Reverse Transcriptase (Takara Bio Inc., Shiga, Japan), as directed by the manufacturer.

Takehara M., Murata S., Katakura K., Fujisawa S., Hmoon M.M., Win S.Y., Bawm S., Htun L.L., Aung Y.H., Win M.M., Isezaki M., Maekawa N., Okagawa T., Konnai S, & Ohashi K. (2019). Haematophagous mites on poultry farms in the Republic of the Union of Myanmar. Heliyon, 5(4), e01544.

+ Open protocol

+ Expand

Total RNA Isolation and RNA-Seq Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from each cell line using a Fast Gene RNA Premium Kit (Nippon Genetics) according to the manufacturer's instructions. The samples were confirmed to have a purity of at least OD260/280 1.7 and OD260/230 1.8, with no degradation or contamination. The extracted total RNA was entrusted to Filgen (Ehime, Japan) and subjected to RNA sequencing analysis at Novogene (Beijing, China). RNA sequencing and bioinformatics analyses were conducted by Novogene using an Illumina NovaSeq 6000 instrument (Illumina). Differences in gene expression were visualized using volcano plots.

Takahashi H., Sakakibara‐Konishi J., Furuta M., Shoji T., Tsuji K., Morinaga D., Kikuchi E., Kikuchi J., Noguchi T., Hatanaka K.C., Hatanaka Y., Shinagawa N, & Konno S. (2022). Notch pathway regulates osimertinib drug‐tolerant persistence in EGFR ‐mutated non–small‐cell lung cancer. Cancer Science, 114(4), 1635-1650.

+ Open protocol

+ Expand

Quantitative Analysis of NOTCH Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using a Fast Gene RNA Premium Kit (Nippon Genetics), according to the manufacturer's instructions. RNA was reverse‐transcribed into cDNA using TaqMan reverse transcription reagents and random hexamers (Applied Biosystems). mRNA expression was determined using qRT‐PCR and a StepOnePlus Real‐Time PCR System (Applied Biosystems) according to the manufacturer's instructions. TaqMan Universal PCR Master Mix with NOTCH1, HES1, HEY1, and GAPDH assays (Applied Biosystems) was used. The following primers were also used to verify reference gene expression: GAPDH forward 5′‐CTGACTTCAACAGCGACACC‐3′ and reverse 5′‐TGCTGTAGCCAAATTCGTTG‐3′. The mean expression level of each gene was determined relative to that of GAPDH. Three independent experiments were performed. Data are presented as the mean ± SD. Statistical significance was set at p < 0.05.

+ Open protocol

+ Expand

Capsaicin-treated ciBA Transcriptome Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA-Seq results in the control fibroblasts (NoC) and ciBAs (RoFB) have been previously reported^{36 (link)}. In this study, total RNA was prepared from Capsaicin-treated ciBAs (RoFB + Capsaicin) derived from HDF38 by FastGene RNA Premium Kit (Nippon Genetics, Tokyo, Japan). RNA integrity number (RIN) values were over 9 in all the RNA samples. The library was prepared by TruSeq stranded mRNA LT Sample Prep Kit (Illumina, CA, USA), following the manufacturer’s low sample (LS) protocol. A 100 bp paired-end sequencing was performed by NovaSeq 6000 System (Illumina). Trimmed reads were mapped to a reference genome (NCBI GRCh37) with HISAT2. After the read mapping, StringTie was used for transcript assembly. After the assembly, the abundance of gene/transcript was calculated from the read counts and normalised as fragments per kilobase of transcript per million mapped sequence reads (FPKM). For identification of DEGs, statistical analysis was performed by FC and exact test using edgeR per comparison pair. Significant results satisfying the conditions of |FC|≥ 2 and the exact test p value < 0.05 were selected. If more than one read count value was zero, it was not included in the analysis.

Takeda Y, & Dai P. (2022). Capsaicin directly promotes adipocyte browning in the chemical compound-induced brown adipocytes converted from human dermal fibroblasts. Scientific Reports, 12, 6612.

+ Open protocol

+ Expand

Synthesis of Modified mRNA for Cellular Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine Fam64a-FLAG or EGFP sequence downstream of T7 promoter was cloned into pGEMHE, and was PCR amplified using a primer set (3'-GTAAAACGACGGCCAGT-5' and 3'-CAGGAAACAGCTATGAC-5'). This PCR product was purified using FastGene Gel/PCR Extraction Kit (Nippon Genetics, Japan), and was used as the template for modified mRNA synthesis. In vitro transcription was performed using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, USA) with a customized ribonucleoside blend of GTP (1.5 mM), ATP (7.5 mM), CTP (7.5mM), N1-Methylpseudo-UTP (7.5 mM, N-1081, TriLink Biotechnologies), and CleanCap® Reagent AG (6 mM, N-7113, TriLink Biotechnologies, USA) (Zangi et al., 2017; (link)Kaur and Zangi, 2020) (link). Following the purification of transcribed mRNA using Fast Gene RNA Premium Kit (Nippon Genetics), Poly (A) tailing reaction was performed using E. coli Poly (A) polymerase (New England Biolabs), and mRNA was re-purified with the same kit. The size and the integrity of synthesized modified mRNA was checked by agarose gel electrophoresis, and quantity was determined using a NanoDrop One spectrophotometer (Thermo Scientific).

Hashimoto K., Kodama A., Ohira M., Kimoto M., Nakagawa R., Usui Y., Ujihara Y., Hanashima A., & Mohri S. (2021). Transient induction of cell cycle promoter Fam64a improves cardiac function through regulating Klf15-dependent cardiomyocyte differentiation in mice.

+ Open protocol

+ Expand

Synthesis of Modified mRNA with FLAG or EGFP

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine Fam64a-FLAG or EGFP sequence downstream of T7 promoter was cloned into pGEMHE, and was PCR amplified using a primer set (3′-GTAAAACGACGGCCAGT-5' and 3′-CAGGAAACAGCTATGAC-5′). This PCR product was purified using FastGene Gel/PCR Extraction Kit (Nippon Genetics, Japan), and was used as the template for modified mRNA synthesis. In vitro transcription was performed using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, USA) with a customized ribonucleoside blend of GTP (1.5 mM), ATP (7.5 mM), CTP (7.5mM), N1-Methylpseudo-UTP (7.5 mM, N-1081, Tri-Link Biotechnologies), and CleanCap® Reagent AG (6 mM, N-7113, Tri-Link Biotechnologies, USA) (Zangi et al., 2017 (link); Kaur and Zangi, 2020 (link)). Following the purification of transcribed mRNA using Fast Gene RNA Premium Kit (Nippon Genetics), Poly (A) tailing reaction was performed using E. coli Poly (A) polymerase (New England Biolabs), and mRNA was re-purified with the same kit. The size and the integrity of synthesized modified mRNA was checked by agarose gel electrophoresis, and quantity was determined using a NanoDrop One spectrophotometer (Thermo Scientific).

Hashimoto K., Kodama A., Ohira M., Kimoto M., Nakagawa R., Usui Y., Ujihara Y., Hanashima A, & Mohri S. (2022). Postnatal expression of cell cycle promoter Fam64a causes heart dysfunction by inhibiting cardiomyocyte differentiation through repression of Klf15. iScience, 25(5), 104337.

+ Open protocol

+ Expand

Murine Diabetes Metabolic Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All experimental procedures were approved by the Animal Committee of Gifu University (H30-040). C57BL/6J and db/db mice (10 W, males) were purchased from SLC Japan (Shizuoka, Japan). The animals were maintained under a 12 h light/dark cycle (08:00-20:00).
Metformin hydrochloride (COMBI-BLOCKS, San Diego, CA, USA) and wood creosotes were re-suspended in 0.5% Tween 80 (Kanto Kagaku, Tokyo, Japan). The drugs were orally administrated at 8:00-9:00 am. Recovery of organs was performed under anesthesia with 3% isoflurane (Wako, Osaka, Japan) and they were fixed with 4% paraformaldehyde/phosphate buffer saline (PBS, Wako) for 1 h.
The intestinal mucosal fractions were peeled off from the muscle layers by rubbing two glass slides. The recovered fractions were directly suspended in the RNA isolation buffer RL (Fast Gene RNA Premium kit, Nippon Genetics, Tokyo, Japan) for mRNA analysis and 3 × sodium dodecyl sulfate (SDS) buffer (75 mM Tris-HCl [pH 6.5], 0.3% SDS, 12.5% glycerol, 0.25% bromophenol blue, and 10% 2-mercaptoethanol) for protein analyses.

Mizoguchi M., Takemori H., Furukawa S., Ito M., Asai M., Morino H., Miura T., Yabe D, & Shibata T. (2023). Increased expression of glucagon-like peptide-1 and cystic fibrosis transmembrane conductance regulator in the ileum and colon in mouse treated with metformin. Endocrine journal, 70(2).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!