Ecori

Short hairpin RNA (shRNA) oligos targeting USP9X (Table S3) were ligated into the pLKO.1 vector digested by AgeI and EcoRI (Addgene, Beijing, China). USP9X was ligated into pLVX-puro (Clontech, Mountain View, CA). The plasmids mentioned above, with psPAX2 and pMD2.G plasmids, were then used to transfect 293T cells to produce lentivirus [30 (link)].

The template used for producing the DNA of the IGR and the control was pCF10 or pRS01, respectively (Table S2). A touchdown PCR was done with Phusion polymerase and a starting annealing temperature of 72°C with a decrease of 1°C/cycle. The PCR products were cloned into pRAV23 (Addgene) using EcoRI and HindIII restriction sites and transformed into Top10 cells. The cells were grown followed by miniprep (Qiagen) for plasmid isolation. The plasmids were digested with EcoRI (Thermo Fisher) and HindIII (Thermo Fisher) using the Fast Digest buffer (Thermo Fisher) and used as a template for T7 in vitro transcription. The T7 reaction mixture consisted of 9 mM MgCl₂, 4 mM ribonucleotide triphosphates (rNTPs), 1× transcription buffer (Thermo Fisher), 2.5 to 5 μg DNA, and 0.05 mg/ml T7 RNA polymerase (Thermo Fisher) and in a 50-μl reaction volume, with incubation at 37°C for 1 h. The RNA was treated with proteinase K (Sigma) and DNase I (Sigma) according to manufacturer’s instructions. Afterward, the RNA was isolated by successive rounds of EtOH precipitation, and the dried pellet was resuspended in double-distilled water (ddH₂O) at the desired concentrations.

We designed 19, 21, and 23 nt guide RNAs that were complementary to the target RNA and positioned them upstream or downstream of the MS2-RNA (Table 1). The MS2 RNA sequence was amplified using the following primers: MS2RNARv, ATTCCTCGAGCGCAAATTTAAAGCGCTGAT; MS2RNAFw, GATTACGAATTCGAATGGCCATG. Each guide sequence was inserted into the pCS2+ plasmid (Addgene) at the EcoRI and XhoI restriction sites [15 (link)]. Briefly, the pCS2+ plasmid and a PCR product comprising the MS2-RNA (6×) and guide RNA sequence were digested with EcoRI and Xhol (Takara, Shiga, Japan) in separate reactions. The digested vector was incubated for 30 min with bovine alkaline phosphatase, followed by ethanol precipitation. The purified products were separated by 1% agarose gel electrophoresis and the desired bands were extracted during a short exposure to UV transillumination. A Qiagen gel extraction kit (Qiagen, Hilden, Germany) was used to purify the vector and insert. Subsequently, ligation was performed using Mighty Mix (Takara), according to the manufacturer’s instructions.