RT-PCR was carried out as described earlier (Pelis, Shahidullah et al. 2009 (link)). Briefly, 0.5 μg total RNA was reverse transcribed to cDNA by using SuperScript III Reverse Transcriptase (Thermo Scientific, USA) following manufacturer’s protocol on an Applied Biosystem Gene Amp PCR System (Model 9700; Thermo Scientific, USA). Complementary DNA (5μl) was used for PCR reaction for gene amplification using Platinum Pfx DNA Polymerase kit (Thermo Scientific, USA) following manufacturer recommended protocol. The studies used custom-designed TRPV1 primers (Integrated DNA Technologies, Inc., IA, USA) for pig (forward: 5′-GGACAAGCTGTGGGAATCAT-3′, reverse: 5′-TGGGATTCGCTACCTTTCAG-3′) and for human (forward: 5′-AAGCCCAGGAAAACACCTTT-3′, reverse: 5′-CTGCTGCAACAGCTTGATTC-3′). We used a 2-min hold at 94°C and then 35 30sec cycles of denaturing at 94°C, 30 sec annealing at 55°C, and an extension at 72°C for 1 min. At the end of the reaction PCR product was analyzed by electrophoresis on an agarose gel (2%) containing ethidium bromide (0.2μg/ml). ϕX174 DNA Marker Hae III Digest was used as base pair standards. Signals were visualized by UV exposure employing a benchtop UV transilluminator (UVP Inc., USA). Images were captured using a high resolution camera.
Platinum pfx dnapolymerase kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany
The Platinum Pfx DNA Polymerase kit is a high-fidelity DNA polymerase designed for PCR amplification. It provides efficient and accurate DNA synthesis with exceptional proof-reading capabilities.
Automatically generated - may contain errors
Lab products found in correlation
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Lightcycler 480 sybr green 1 master kit, by Roche (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Rnase free dnase, by Qiagen (1 mentions)
Pdonr221, by Thermo Fisher Scientific (1 mentions)
Hiseq 2000, by Illumina (1 mentions)
Magnetic methylated dna immunoprecipitation kit, by Diagenode (1 mentions)
Bioruptor ngs system, by Diagenode (1 mentions)
Paired end dna sample prep kit, by Illumina (1 mentions)
Agencourt ampure beads, by Beckman Coulter (1 mentions)
6 protocols using platinum pfx dnapolymerase kit
1
RT-PCR Analysis of TRPV1 Expression
2
Rat GnRH-Luciferase Reporter Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The -5 kb rat Gnrh1-luciferase reporter and 5’ truncations were generated as previously described [14 (link)]. The rat GnRH-E1/GnRH-P luciferase reporter in pGL3 vector have been previously described [32 (link), 33 (link)]. The luciferase reporters carrying the Rous sarcoma virus (RSV) long terminal repeat enhancer and promoter RSVe/RSVp, GnRH-E1/RSVp, RSVe/GnRH-P, and GnRH-E1/RSVp on pGL3 vector have been previously described [15 (link)]. The mouse GnRH-E1 RNA expression plasmid was constructed by PCR amplification of the 2432 bp (-3560 bp/-1128 bp) segment from GT1-7 neuron genomic DNA using Platinum Pfx DNA polymerase kit (Thermo Fisher Scientific, Carlsbad, CA). The segment was inserted at the EcoR1 restriction enzyme digest site of the pcDNA 2.1 (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA) backbone plasmid using T4 DNA ligase (New England Biolabs, Ipswich, MA). Plasmid constructs carrying -3560 bp/-1128 bp of GnRH-E1 RNA, integrated in the forward or the reverse orientation, were verified by DNA sequencing. For quantitative PCR of the transgene-transcribed rat GnRH-E1 RNA, the standard plasmid was constructed by cloning -2854 bp/-1156 bp segment of the rat transgene from GT1-7 neuron genomic DNA into the EcoR1 restriction enzyme digest site of the pcDNA 2.1 backbone plasmid.
3
Site-directed mutagenesis of mannanase enzymes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutants were constructed
using primers designed with the Agilent Technologies online webserver
(https://www.genomics.agilent.com/ ) and purchased from
Bio-Synthesis, Inc. Forward and reverse primers containing the mutations
of interest are listed inTable S1, Supporting
Information . PCR reactions (30 μL) contained 1 mM MgCl2, 1× Pfx Amp buffer, 0.33 mM dNTP, 0.33 μM of FOR/REV
primer, and 1.25 units Pfx polymerase (Invitrogen Platinum Pfx DNA
Polymerase kit). The templates were 50 ng ManD-containing pET15b (NaManD) or pET17b (CsManD). Amplifications
were performed according to the manufacturer’s guidelines.
After addition of DpnI (10 units), the reactions were incubated for
4 h at 37 °C. The DpnI-digested products were purified by gel
electrophoresis, extracted, and transformed (electroporation, Bio-Rad
Micropulsar Electroporator) into XL1 Blue competent cells. Finally,
plasmids isolated from the transformants were sequenced to confirm
the mutations.
using primers designed with the Agilent Technologies online webserver
(
Bio-Synthesis, Inc. Forward and reverse primers containing the mutations
of interest are listed in
Information
primer, and 1.25 units Pfx polymerase (Invitrogen Platinum Pfx DNA
Polymerase kit). The templates were 50 ng ManD-containing pET15b (NaManD) or pET17b (CsManD). Amplifications
were performed according to the manufacturer’s guidelines.
After addition of DpnI (10 units), the reactions were incubated for
4 h at 37 °C. The DpnI-digested products were purified by gel
electrophoresis, extracted, and transformed (electroporation, Bio-Rad
Micropulsar Electroporator) into XL1 Blue competent cells. Finally,
plasmids isolated from the transformants were sequenced to confirm
the mutations.
4
Transcriptional Analysis of C. salexigens Metabolism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C. salexigens DSM3043 was grown to an optical
density (absorbance at 600 nm) of
0.4–0.5 in M9 minimal salts medium with additional NaCl (1.7
M NaCl, 6.1 mM Na2HPO4, 3.9 mM KH2PO4, 9.3 mM NH4Cl, 0.5 mM MgSO4,
and 0.5 mM CaCl2) and 10 mMd -mannonate, 10 mM l -gulonate, 10 mM d -glucuronate, or 10 mM d -glucose. Cells were pelleted at 15000 rpm, and the supernatant was
removed. mRNA was purified from the cells using an RNeasy Mini Kit
(Qiagen). The RNA was further purified using RNase-free DNase (Qiagen)
following the manufacturer’s protocol. The purity was verified
using 30 μL PCR mixtures consisting of 50 ng of mRNA, 1 mM MgCl2, 1× Pfx Amp Buffer, 2× PCR enhancer, 0.33 mM dNTP,
0.33 μM primers [CsRpoD_RTPCR_FOR and CsRpoD_RTPCR_REV (Table
S1 of theSupporting Information )], and
1.25 units of Pfx polymerase (Invitrogen Platinum Pfx DNA Polymerase
kit). The PCR mixtures were electrophoresed on an agarose gel to check
for amplification. cDNA was prepared using Protoscript First Strand
(New England Biolabs) and 1 μg of mRNA; the manufacturer’s
protocol was followed. The qRT-PCR was performed using the Light Cycler
480 SYBR Green I Master Kit (Roche) and a Light Cycler 480 II (Roche)
according to the manufacturer’s protocol. The qRT-PCR primers
are listed in Table S1 of theSupporting Information . Cp values were analyzed
using the Light Cycler 480 application and fold changes calculated
in Microsoft Excel.
density (absorbance at 600 nm) of
0.4–0.5 in M9 minimal salts medium with additional NaCl (1.7
M NaCl, 6.1 mM Na2HPO4, 3.9 mM KH2PO4, 9.3 mM NH4Cl, 0.5 mM MgSO4,
and 0.5 mM CaCl2) and 10 mM
removed. mRNA was purified from the cells using an RNeasy Mini Kit
(Qiagen). The RNA was further purified using RNase-free DNase (Qiagen)
following the manufacturer’s protocol. The purity was verified
using 30 μL PCR mixtures consisting of 50 ng of mRNA, 1 mM MgCl2, 1× Pfx Amp Buffer, 2× PCR enhancer, 0.33 mM dNTP,
0.33 μM primers [CsRpoD_RTPCR_FOR and CsRpoD_RTPCR_REV (Table
S1 of the
1.25 units of Pfx polymerase (Invitrogen Platinum Pfx DNA Polymerase
kit). The PCR mixtures were electrophoresed on an agarose gel to check
for amplification. cDNA was prepared using Protoscript First Strand
(New England Biolabs) and 1 μg of mRNA; the manufacturer’s
protocol was followed. The qRT-PCR was performed using the Light Cycler
480 SYBR Green I Master Kit (Roche) and a Light Cycler 480 II (Roche)
according to the manufacturer’s protocol. The qRT-PCR primers
are listed in Table S1 of the
using the Light Cycler 480 application and fold changes calculated
in Microsoft Excel.
5
Cloning and Visualization of PsTrxo1-GFP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequence of PsTrxo1 was amplified using the Platinum Pfx DNA Polymerase Kit (Invitrogen, Germany) with the following primers for C-terminal fusion proteins with the stop codon omitted:
attB1- PsTrxo1 AAAAAAGCAGGCTTCATGGTTGGAACCAGAAATTT
attB2-PsTrxo1 CAAGAAAGCTGGGTCGTCCTTCTTGAAGAGTTTCTC
The recognition sequences for BP Recombinase II (Invitrogen, Germany) are underlined. The PCR product was purified and cloned into the entry vector pDONR221 (Invitrogen, Germany) and sequenced. Then, the coding sequence of PsTrxo1 was subcloned with a Gateway LR recombinase into the constitutive expression vector pMDC83. A. tumefaciens strain GV3101 containing the plasmid pMDC83 with the construction 35S::PsTrxo1-GFP was transformed as described in [52] and grown in Luria-Bertani medium (OD600 nm 0.8–1.1) and then TBY-2 control cells were agroinfiltrated 3 days before subcultivation at 1:40 (v/v bacteria/cells) and incubated in the dark at 26ᵒC for 24 h. Visualization with a confocal microscopy was performed after double staining using 5 mL of cells incubated with 0.5 µM Mito-Tracker Deep-Red 633 and 10 µM DAPI (4,6-diamidino-2-phenylindole) for 10 min at room temperature in the dark.
attB1- PsTrxo1 AAAAAAGCAGGCTTCATGGTTGGAACCAGAAATTT
attB2-PsTrxo1 CAAGAAAGCTGGGTCGTCCTTCTTGAAGAGTTTCTC
The recognition sequences for BP Recombinase II (Invitrogen, Germany) are underlined. The PCR product was purified and cloned into the entry vector pDONR221 (Invitrogen, Germany) and sequenced. Then, the coding sequence of PsTrxo1 was subcloned with a Gateway LR recombinase into the constitutive expression vector pMDC83. A. tumefaciens strain GV3101 containing the plasmid pMDC83 with the construction 35S::PsTrxo1-GFP was transformed as described in [52] and grown in Luria-Bertani medium (OD600 nm 0.8–1.1) and then TBY-2 control cells were agroinfiltrated 3 days before subcultivation at 1:40 (v/v bacteria/cells) and incubated in the dark at 26ᵒC for 24 h. Visualization with a confocal microscopy was performed after double staining using 5 mL of cells incubated with 0.5 µM Mito-Tracker Deep-Red 633 and 10 µM DAPI (4,6-diamidino-2-phenylindole) for 10 min at room temperature in the dark.
6
Genome-wide DNA Methylation Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-blood samples (6 mL) were collected and stored at −80°C in EDTA tubes. Genomic DNA was extracted using the BACC3 Genomic DNA Extraction kit (Nucleon) and stored in TE buffer at −20°C. A total of 1.5 μg of genomic DNA was fragmented to a smear of 200–500 bp with the Bioruptor NGS System (Diagenode) and was subsequently end repaired, adenylated, and adapter ligated using the Paired-End DNA Sample Prep kit (Illumina). Methylated DNA was immunoprecipitation using the Magnetic Methylated DNA Immunoprecipitation kit (Diagenode) as previously described (24 (link)). After efficiency and sensitivity assessment by quantitative PCR, MeDIP-seq libraries were prepared by amplification (Platinum pfx DNA Polymerase kit; Invitrogen), purification (Agencourt Ampure Beads; Beckman Coulter) and validation (Agilent BioAnalyzer analysis) followed by high-throughput sequencing (Illumina HiSeq2000) that generated approximately 50 million, 50-bp single-end reads.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!