Log In Sign up
The largest database of trusted experimental protocols

Sybr green rox fast qpcr premix

Manufactured by Qiagen
Visit Supplier

SYBR Green Rox Fast qPCR premix is a ready-to-use solution for quantitative PCR (qPCR) applications. It contains SYBR Green I dye, Rox passive reference dye, and all necessary components for fast and sensitive real-time PCR.

Automatically generated - may contain errors

Lab products found in correlation

Mirneasy mini kit, by Qiagen (2 mentions) Quantitect reverse transcription kit, by Qiagen (2 mentions)

Spelling variants of this product

SYBR Green (372 citations) Fast SYBR Green (10 citations) SYBR-Green Premix (7 citations) SYBR Premix (7 citations) QPCR SYBR Green (2 citations)

2 protocols using sybr green rox fast qpcr premix

1

Quantitative Analysis of CFTR Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using the miRNeasy Mini Kit (Qiagen) followed by reverse transcription with the QuantiTect reverse transcription kit (Qiagen). The abundance of transcripts was determined using RT2 (link) SYBR Green Rox Fast qPCR premix (Qiagen) with an Mx3005P real-time cycler (Stratagene). CFTR was detected with the following primers: sense gaggaaaggatacagacagcgcctg and antisense gaagccagctctctatcccattc. Variations in RNA loading amount were accounted for by normalizing to GAPDH (sense primer catgagaagtatgacaacagcct, antisense primer agtccttccacgataccaaagt).
Veit G., Xu H., Dreano E., Avramescu R.G., Bagdany M., Beitel L.K., Roldan A., Hancock M.A., Lay C., Li W., Morin K., Gao S., Mak P.A., Ainscow E., Orth A.P., McNamara P., Edelman A., Frenkiel S., Matouk E., Sermet-Gaudelus I., Barnes W.G, & Lukacs G.L. (2018). Structure-guided combination therapy to potently improve the function of mutant CFTRs. Nature medicine, 24(11), 1732-1742.
+ Open protocol
+ Expand
2

Quantitative Analysis of CFTR Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using the miRNeasy Mini Kit (Qiagen) followed by reverse transcription with the QuantiTect reverse transcription kit (Qiagen). The abundance of transcripts was determined using RT2 (link) SYBR Green Rox Fast qPCR premix (Qiagen) with an Mx3005P real-time cycler (Stratagene). CFTR was detected with the following primers: sense gaggaaaggatacagacagcgcctg and antisense gaagccagctctctatcccattc. Variations in RNA loading amount were accounted for by normalizing to GAPDH (sense primer catgagaagtatgacaacagcct, antisense primer agtccttccacgataccaaagt).
Veit G., Xu H., Dreano E., Avramescu R.G., Bagdany M., Beitel L.K., Roldan A., Hancock M.A., Lay C., Li W., Morin K., Gao S., Mak P.A., Ainscow E., Orth A.P., McNamara P., Edelman A., Frenkiel S., Matouk E., Sermet-Gaudelus I., Barnes W.G, & Lukacs G.L. (2018). Structure-guided combination therapy to potently improve the function of mutant CFTRs. Nature medicine, 24(11), 1732-1742.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!