Eva green dye

Spo11 mutants were generated using TALENs targeting the second exon of spo11. The TALENs were assembled and injected as previously described [97 (link)]. The TALEN sequences were: HD-NG-NI-NI-NI-NN-NN-NG-NN-NI-NI-NN-HD-NI-HD-half repeat HD, and NG-HD-HD-NI-NN-HD-NI-NN-NN-NI-NG-HD-NG-NI-NG-half repeat NG. Injected founder fish were raised to adulthood and outcrossed to wild type fish; the resulting offspring were screened for mutations in spo11 via high resolution melt (HRM) analysis and subsequent sequencing. HRM primer sequences are: fwd TCACAGCCAGGATGTTTTGA, and rev CACCTGACATTGTTCCAGCA. The HRM analysis was performed with either Light Scanner Master Mix (BioFire Defence, Murray, UT, Catalog# HRLS-ASY-0003), 10X LCGreen Plus+ Melting Dye (Biofire Defence, Catalog# BCHM-ASY-0005), or 20X Eva Green dye (VWR, Radnor, PA, Catalog# 89138–982) using a CFX-96 real-time PCR machine and Precision Melt Analysis software (BioRad, Hercules, CA). The data presented in this paper is from individuals of a population with an 11 bp deletion mutation in exon 2 that has been outcrossed 2–3 times.

The rad21l1^uc89 mutants were generated using transcription activator-like effector nucleases (TALENs) to target exon 2 and genotyped using high resolution melt analysis (HRMA). TALEN target sequences: NG-NI-NG-NH-HD-HD-HD-NI-NI-HD-NG-HD-NG-NG-HD-NI-HD-HD-half repeat NG and NH-HD-NH-NI-NH-HD-HD-NI-NH-NI-NG-NG-NG-NG-NH-NH-HD-NH-half repeat NI. Injected founder fish were raised to adulthood and outcrossed to wild-type fish. The resulting offspring were screened for mutations in rad21l1 via HRMA and subsequent sequencing. HRMA primer sequences are: Fwd: 5’-CGCCGAGACATGTTTTATGCCC-3’, Rev: 5’-TCAAACACGTGGGCTTTGGT-3’. HRMA was performed with 20X Eva Green dye (VWR, Radnor, PA, Catalog #89138–982) using a CFX-96 real time PCR machine and Precision Melt Analysis software (BioRad, Hercules, CA). Mutants were backcrossed to either AB or NHGRI strain. The sex reversal phenotype was specific to populations genotyped as rad21l1^-/- indicating that it is unlikely due to off-target effects. The phenotype correlation remained consistent through 5–6 crosses.