Simplechip

The CHIP assay was performed as described previously [43 (link)]. Briefly, HepG2 cells were treated with 15 μM (−)-oleocanthal for 12 hours. The cells were cross-linked by the addition of formaldehyde at a 1% final concentration, chromatin was sonicated, and immunoprecipitation was performed using 1 μg of STAT3, c-fos and IgG antibody. The CHIP assay was performed using a commercially available CHIP assay kit (Simple CHIP, Cell Signaling Technology) according to the manufacturer's instructions. Twist mRNA levels were evaluated using RT-PCR. Human Twist promoter sequences were detected in the immunoprecipitates using PCR with the following primers: forward, 5′-AGTCTCCTCCGACCGCTTCCTG-3′, reverse, 5′-CTC CGTGCAGGCGGAAAGTTTGG -3′.

HLF cells were seeded onto 15 cm dishes and incubated until reaching about 80% confluency. Cells were fixed with 1% formaldehyde in PBS for 15 min and quenched with 2.5 M glycine for 5 min. Subsequently, cells were harvested in RIPA buffer supplemented with 1 × Protease Inhibitor Mix G and sonicated to generate DNA fragments of less than 500 bp. After preclearing, samples were mixed with 2 µg of specific antibody or IgG as control and Dynabeads, followed by incubation at 4 °C overnight. After several washing steps (4 × RIPA, 4 × IP wash buffer, 2 × TE), the protein-DNA complexes were eluted from the Dynabeads. Cross-linking was reversed by adding 4 M NaCl and incubation at 65 °C for 5 h. DNA was purified using the NucleoSpin® Gel and PCR Clean-up Kit according to the manufacturer’s instructions. Finally, precipitated DNA was quantified with qPCR using a serial dilution of genomic DNA to calculate a reference standard curve. ChIP primers were designed based on the TEAD4 binding sites identified by ChIP-Seq data analysis and the prediction of TEAD4 binding sites using the JASPAR database [67 (link)]. Commercially available primers covering the human CTGF promoter and primers covering the CTGF upstream region without transcription factor binding site were employed as positive and negative controls, respectively (SimpleChIP®, Cell Signaling).