M1701

Total RNA was extracted from the liver tissue by using TRIzol^® reagent (15596026, Invitrogen, Carlsbad, CA, USA) and was then submitted to reverse transcription to yield cDNA with an oligodeoxynucleotide primer (oligo dT15)-based method according to the manufacturer’s protocol (M1701, Promega, Madison, WI, USA). The qPCR reaction for Il6 and Il1β and normalization control Gapdh were conducted with 2× SYBR Green PCR Master Mix (04887352001, Roche, CA, USA) on a LightCycler480^® (Roche). Each PCR reaction included 0.5 μM forward and reverse primers, 30 ng of cDNA, and 1× SYBR Green PCR Master Mix in a total reaction volume of 10 μL. The qPCR program included an initial denaturation step at 95 °C for 10 min, followed by 45 cycles of denaturation at 95 °C for 30 s, annealing at 62 °C for 15 s, and extension at 72 °C for 25 s, with a final step for melting curve analysis. The primers sequence was as follows: Il6 forward 5′-GACAAAGCCAGAGTCCTTCAGA-3′, Il6 reverse 5′-AGGAGAGCATTGGAAATTGGGG-3′; Il1β forward 5′-TAACCTGCTGGTGTGTGAC-3′, Il1β reverse sequence 5′-CATTGAGGTGGAGAGCTTTC-3′; Gapdh forward 5′-GCACAGTCAAGGCCGAGAAT-3′, Gapdh reverse sequence 5′-GCCTTCTCCATGGTGGTGG-3′. We based the calculation of relative gene expression on the comparative cycle threshold (CT) method, whereby the value of the target gene was given by 2^{−(ΔCT target−ΔCT calibrator)} or 2^−ΔΔCT.

TRIzol (15596026; Invitrogen) agent was used to extract total mRNA from human bladder cancer cells or tissues. mRNA was then reverse transcribed to produce cDNA by synthesis system (M1701; Promega, Madison, WI, USA). qPCR was performed using SYBR Ex Taq kit (638319; Takara, Osaka city, Osaka prefecture, Japan), and KIF3A levels were normalized to endogenous GAPDH level.

TRIzol (15596026, Invitrogen, CA, USA) agent was used to extract total mRNA from human osteosarcoma cells. Subsequently, the total RNA was reverse transcribed by a reverse transcriptase (M1701, Promega, Wisconsin, USA) kit. Additionally, total mRNA was then reverse transcribed to produce cDNA by the use of a synthesis system. Quantitative PCR was subsequently conducted using the SYBR Ex Taq kit (638319, Takara, Japan), and the expression levels of KIF2A were normalized to the expression of GAPDH.

Total RNA was extracted by using TRIzol^® reagent (15596026, Invitrogen, Carlsbad, CA, USA) from the liver tissue and then underwent reverse transcription to yield cDNA with an oligodeoxynucleotide primer (oligo dT15)-based method according to the manufacturer’s protocol (M1701, Promega, Madison, WI, USA). The qPCR reaction for Gsk3b, and normalization control beta-actin was conducted with 2× SYBR Green PCR Master Mix (04887352001, Roche Molecular Systems, Inc., Pleasanton, CA, USA) on LightCycler480^® (Roche). Each PCR reaction included 0.5 μM forward and reverse primers, 30 ng of cDNA, and 1× SYBR Green PCR Master Mix in a total reaction volume of 10 μL. The qPCR program included an initial denaturation step at 95 ℃ for 10 min, followed by 45 cycles of denaturation at 95 ℃ for 30 s, annealing at 62 ℃ for 15 s, and extension at 72 ℃ for 25 s, with a final step for melting curve analysis. The primers sequence was as follows: Gsk3b forward 5′- GAGCTGATGACTAGGGCTGT -3′, Gsk3b reverse 5′- GTATA AGGGCCGCCAAGAGA -3′; beta-actin forward 5′-CAGCCTTCCTTCTTGGGTATG-3′, beta-actin reverse sequence 5′-GGCATAGAGGTCTTTACGGATG-3′. The calculation of relative gene expression was based on the comparative cycle threshold (CT) method, whereby the value of the target gene was given by 2^{−(△CT target−△CT calibrator)} or 2^−△△CT.

To validate the differential expression pattern of DEGs obtained by Illumina sequencing, qRT-PCR of all of 16 differentially expressed TFs and 21 randomly chosen DEGs was conducted using the total RNA extracted from PRs of six 4-day-old plants of each accession. Gene-specific primers were designed using Primer 3 (http://fokker.wi.mit.edu/primer3/input.htm), and the primer sequences are presented in Table S2. Approximately 3.0 μg of total RNA for each sample was reversed following the instructions of a reverse transcription kit (Cat. M1701, Promega), and first-strand cDNA was amplified according to the instructions for RealMasterMix (SYBR Green [FP202]; TIANGEN). The B. napus ACTIN2 gene-specific primer (Table S2) was used as a control to normalize the expression data. The results were analyzed using CFX Manager Software using the 2^−ΔΔCT method.

Total RNA was extracted from MonoMac6 cells using the RNeasy Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. mRNA of 2 μg total RNA was transcribed into complimentary DNA (cDNA) using a reverse transcriptase kit (M1701, Promega, Madison, WI, USA).