The largest database of trusted experimental protocols

3 protocols using prime script rt master mix

1

Nrf2 Expression Quantification via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cell lines using TRIzol reagent (Invitrogen, USA). RNA concentration was determined using a Synergy H1 spectrophotometer (BioTek Instruments, Inc., USA). Reverse transcription was performed using Prime Script RT Master Mix (Transgen Biotech, Beijing, China). qRT-PCR was performed with SYBR Premix Ex Taq (TaKaRa Bio., Beijing, China) using Applied Biosystems Quant Studio 5 (Thermo Fisher Scientific, Shanghai, China). Fold changes in Nrf2 expression were calculated using the 2−ΔΔCt method and normalized to β-actin expression. The primers are presented as Table 2.

Sequence Information

NameSequence (5′ → 3′)
human Nrf2-FCCAATTCAGCCAGCCAGCACAT
human Nrf2-RCAGGTGACTGAGCCTGATTAGTAG
human β-actin-FCATGTACGTTGCTATCCAGGC
human β-actin-RCTCCTTAATGTCACGCACGAT
+ Open protocol
+ Expand
2

Quantitative Analysis of HSV-1 Viral Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Nucleospin RNA Kit (Takara, Dalian, China) was used to extract the total RNA from samples. cDNA was synthesized using Primescript RT Master Mix (Transgen, Beijing, China) obeying the manufacturer’s guidance. qPCR was launched using SYBR Premix Ex Taq II (Vazyme, Nanjing, China) and Applied Biosystems 7500 Real-Time PCR system (Applied Biosystems, Foster City, USA) to measure HSV-1 virus DNA. The cycle condition was 95°C for 30s, followed by 40 two-step cycles (95°C for 5s, 60°C for 30s). The primers for the genes RPL5, HSV-1 ICP0, TK, VP16, mrpl5, il-6, il-1α, tnf-α, nlrp3, caspase 1 and il-1β are provided in Table 1 and the relative gene expression was determined based on deactivation with the housekeeping gene as described previously.30 (link)

Primers Used for qPCR

No.GeneForward PrimerReverse Primer
1.RPL5GGAAGCACATCATGGGTCAGATACGCATCTTCATCTTCCTCCATT
2.ICP0GGCCCCCTTGTCAACAGAGGGAGTCGCTGATCACTATGG
3.VP16GCGGGGCCGGGATTTACCCTCGAAGTCGGCCATATCCA
4.TKAAGGTCGGCGGGATGAGCGGCCGCGCGATAC
5.il1bCTTTCCCGTGGACCTTCCACTCGGAGCCTGTAGTGCAGTT
6.tnf-aACAAGGCTGCCCCGACTACTGGGCTCATACCAGGGTTTG
7.il6ACCACTCCCAACAGACCTGTCTCAGATTGTTTTCTGCAAGTGCAT
8.il1aGATGAAGCTCGTCAGGCAGAACCTCCCGACGAGTAGGCATA
9.casp1CTGGGACCCTCAAGTTTTGCCCCTCGGAGAAAGATGTTGAAA
10.m-rpl5CCGCAGGCTTCTGAATAGGTCCAGTTGTAGTTCGGGCAAGA
11.nlrp3CTGCGGACTGTCCCATCAATAGGTTGCAGAGCAGGTGCTT
+ Open protocol
+ Expand
3

Exosome Isolation and Characterization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
DMEM and penicillin-streptomycin-glutamine (100×) were purchased from Gibco (Waltham, MA, USA). Fetal bovine serum (FBS) was purchased from Procell Life Science & Technology Co.,Ltd (Wuhan, China). Exosome-depleted FBS was purchased from Cellmax Cell Technology Co., Ltd. (Beijing, China). Lefty1 recombinant plasmid (Gene ID: 498299), negative plasmid and GAPDH primers, U6 primers, α-SMA primers, lefty1 primers were purchased from Genepharma Technology Co., Ltd (Shanghai, China). PKH26 was got from Sigma (St. Louis, MO, USA). TransExo™ serum/plasma exosome total RNA extraction kit and PrimeScript RT master mix were got from TransGen Biotech Co., Ltd (Beijing, China). Plasmocin™ prophylactic, dextran-AlexaFluor555, transferrin-AlexaFluor 555, cholera toxin subunit B-AlexaFluor 555 and DiR were purchased from Invivogen (San Diego, CA, USA). Hoechst33342 and lysotracker green were purchased from Beyotime Biotechnology Co., Ltd. (Shanghai, China). Anti-CD9(ab92726), CD81(ab109201), TSG101 (ab125011), α-SMA(ab7817), collagen I(ab270993) and HRP coupling goat anti-rabbit IgG (ab205718), goat anti-rabbit IgG H&L (Alexa Fluor 488) (ab150077) were purchased from Abcam (Cambridge, UK). Anti-alix (T57215) was purchased from Abmart Medical Technology Co., Ltd. (Shanghai, China). Anti-CD63(AF5117), calnexin (AF5362) were purchased from Affinity Biosciences, Inc. (Cincinnati, OH, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!