Total RNA was extracted from 20 to 40 mg of frozen post-mortem brain tissue, or neuroblastoma SH-SY5Y cells, and lysed using Trizol reagent (ThermoFisher, Cat# 10,296,010). Post-mortem frozen brain samples were obtained from the Massachusetts Alzheimer’s Disease Research Center Neuropathology Core operated under the Massachusetts General Hospital IRB guidelines. A mechanical tissue homogenizer was used for brain tissue. RNA was then purified using Phase Lock Gel Heavy tubes (QuantaBio, Cat# 10847-802) and Isolate RNA Mini Kit (Bioline, Cat#BIO-52073). RNA concentration and quality were measured using nanodrop and 750–1000 ng of total RNA used for cDNA synthesis, using High-Capacity cDNA Reverse Transcription Kit (ThermoFisher, Cat# 4374966) according to the manufacturer’s instructions.
Phase lock gel heavy tubes
Manufactured by Quantabio
Phase Lock Gel Heavy tubes are a specialized laboratory product designed to facilitate efficient phase separation during various molecular biology workflows. The tubes contain a gel-like material that forms a barrier between the aqueous and organic phases, aiding in the separation and recovery of desired components from complex samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions)
Agilent 2100 bioanalyzer pico chip, by Agilent Technologies (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Glycoblue, by Thermo Fisher Scientific (2 mentions)
Isolate rna mini kit, by Meridian Bioscience (1 mentions)
Fragment analyzer, by Agilent Technologies (1 mentions)
Qubit rna hs assay, by Thermo Fisher Scientific (1 mentions)
Qubit dna hs assay, by Thermo Fisher Scientific (1 mentions)
Nebnext ultra 2 directional rna kit, by New England Biolabs (1 mentions)
Novaseq 6000, by Illumina (1 mentions)
Sodium acetate, by Thermo Fisher Scientific (1 mentions)
Zymo rna clean concentrator 5, by Zymo Research (1 mentions)
Turbo dnase, by Thermo Fisher Scientific (1 mentions)
Isopropanol, by Avantor (1 mentions)
Chloroform, by Avantor (1 mentions)
Tri reagent solution, by Thermo Fisher Scientific (1 mentions)
Ethanol, by Merck Group (1 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
3.0 mm beads, by Benchmark Scientific (1 mentions)
11 protocols using phase lock gel heavy tubes
1
Total RNA Extraction from Brain Tissue
2
Bulk PolyA+ RNAseq Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At the TREx Facility, RNA was extracted from Trizol following the manufacturer’s protocol with the following exceptions: the aqueous fraction was re-extracted with an equal volume of chloroform in Phase Lock Gel Heavy tubes (QuantaBio) and 2 μL of GlycoBlue (Thermo) was added prior to precipitation to improve RNA recovery. Total RNA samples were quantified with the Qubit HS RNA assay (Thermo) and integrity assessed on a Fragment Analyzer (Agilent) to confirm RQN values ≥7. Bulk polyA + RNAseq libraries were generated from 25 ng total RNA with the NEBNext Ultra II Directional RNA kit (New England Biolabs). Libraries were quantified with a Qubit HS DNA assay (Thermo) and sequenced on a NovaSeq6000 (Illumina) at Novogene to generate a minimum of 20M PE 2x150bp reads per sample.
3
RNA Extraction from Nanoparticle Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated by adding 500 μL of phenol (acid phenol: CHCl3 5:1 solution (pH 4.5); Ambion cat. #AM9720) to 500 μL of nanoparticle samples (membrane concentration of 2 mg/mL and PLGA nanoparticles of 4 mg/mL) and mixed with gentle vortex for 5 s. The sample mix was incubated at 37 °C with a gentle vortex (~ 1100 rpm) for 15 min and transferred to 2 mL Phase Lock Gel Heavy tubes (Quantabio, cat.# 2302830) and centrifuged at 16,000×g for 5 min. The upper layer or aqueous phase was transferred to and new 2-mL Eppendorf tube and 3 M Sodium acetate (pH 5.5,1:10; Ambion) was added for RNA precipitation followed by 1.5 volume of isopropanol. Samples were incubated at − 20 °C overnight and the next day washed twice with 80% ethanol at 7500g for 5 min at 4 °C. RNA quantification and quality were assessed using Qubit and Bioanalyzer.
4
Efficient RNA Extraction from Frozen Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen cell preparations (100,000 cells in 750 μL of Trizol-LS) were thawed completely at room temperature. 800 μL of the sample was then transferred to pre-spun Phase Lock Gel-Heavy Tubes (Quantabio #2302830) and incubated at room temperature for 5 min. Next, 160 μL of chloroform was added to each tube, vigorously shaken for 15 s, and incubated at room temperature for 2 min. Samples were then centrifuged at 12,000xg for 15 min at 4°C. Following centrifugation, the aqueous phase (∼400 μL) was transferred to fresh 1.7 mL tube. 1 volume of 100% ethanol was added to the recovered aqueous phase and mixed by pipetting. The sample was then transferred to a Zymo RNA Clean & Concentrator-5 (Zymo Research #R1015) spin column and centrifuged at 16,000xg for 30 s. Flow through was discarded at each step prior to elution. 400 μL of RNA Prep Buffer was added to the column and centrifuged at 16,000xg for 30 s. Then the column was washed twice with RNA Wash Buffer. First, with 700 μL at 16,000xg for 30 s and then with 400 μL at 16,000xg for 2 min to dry column. RNA was eluted from column with 10 μL of DNase/RNase-Free water by centrifugation at 16,000xg for 30 s.
5
RNA Extraction and Purification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prior to RNA extraction 4sU-labeled spike-in RNA (in QIAzol) was added in a 1:8 ratio (NIH/3T3:K562). RNA was obtained by chloroform extraction using MaXtract High Density Phase-Lock-Gel tubes. RNA was obtained by isopropanol precipitation for 10 min on ice followed by centrifugation at 20,000 × g and 4 °C for 20 min. The pellet was washed twice with 80% ice-cold ethanol, air-dried, and resuspended in nuclease-free H2O. The samples were treated with TURBO DNase (Thermo Fisher Scientific) according to the manufacturer’s instructions. The reaction was stopped by adding EDTA to the final concentration of 15 mM. RNA was purified using phenol:chloroform:isoamyl alcohol (25:24:1) (ROTH, Cat.# A156) and Phase Lock Gel Heavy tubes (QuantaBio Cat.# 733–2478) by centrifugation for 5 min at 12,000 × g. The RNA was collected by isopropanol precipitation, washed with 85% ethanol and resuspended in nuclease-free H2O.
6
RNA Extraction from Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Neurons cultured in 6‐well plates and astrocytes cultured in 12‐well plates were washed with ice‐cold PBS, and cell lysates were prepared by incubation and scraping in TRI Reagent solution (Invitrogen), pooling 2 wells per condition. Cell lysates were loaded on Phase Lock Gel‐Heavy tubes (Quantabio) and mixed 1:5 with chloroform (VWR Chemicals). The organic and aqueous phases were separated by centrifugation at 12,000 g for 15 min at 4°C. The aqueous phase was mixed 1:1 with Isopropanol (VWR Chemicals) and 150 mg/ml glycoblue (Invitrogen) and centrifuged at 12,000 g for 10 min at 4°C to precipitate RNA. Precipitated RNA was washed with 75% ethanol (Sigma‐Aldrich) and centrifuged at 7,500 g for 5 min. After removal of ethanol, the pellet was air‐dried and dissolved in RNase‐free H2O.
7
Quantifying miR-29a Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were homogenized in TRIzol reagent (Thermo Fisher Scientific, 15596018) and shaken for 15 s after the addition of chloroform. The samples were transferred to pre-spun Phase Lock Gel-Heavy tubes (Quanta bio, 2302830) and incubated at RT for 5 min and then centrifuged at 12,000 g/4 °C for 15 min. The upper phase aqueous solution was collected in a fresh tube and RNA was precipitated by isopropanol. Samples were gently mixed and left at −80 °C overnight and then centrifuged at 14,000 rpm/4 °C for 25 min. RNA pellet was washed twice in 75% ethanol and resuspended in nuclease-free water. miR-29a was reverse transcribed to cDNA using miR-29a-specific primers from TaqMan (Thermo Fisher Scientific, Assay ID: 002112). Real-time polymerase chain reaction was performed using the Applied Biosystems TaqMan Gene Expression assay following the manufacturer’s instruction. Data were analyzed by the △△Ct methods using U6 as an endogenous control.
8
Quantitative Gene Expression Analysis in Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole kidney (or intestine or liver) preserved in RNAlaterTM (Qiagen, #1017980) was homogenized by bead beating using a BeadBugTM6 (Benchtop Scientific) using 3.0 mm beads (Benchmark Scientific, #D1032-30). RNA was isolated using TRIzolTM (Ambion, #15596026) using Phase Lock Gel Heavy tubes (Quantabio, #2302830) for phase separation followed by RNA clean up using the RNeasy® Mini Plus kit (Qiagen, #74134). 5 µg of RNA was then transcribed into cDNA using the SuperScriptTM III First-Strand Synthesis System (Invitrogen, #18080051). 10 ng of the resulting cDNA was used as template for qRT-PCR using PowerUpTM SYBRTM Green Master Mix (Applied Biosystems, #A25742), run using the QuantStudio 3 Real Time PCR System (Applied Biosystems). Manufacturer’s specifications were followed for all reagents listed above. Primers were validated previously51 (link)–57 (link) and used the following sequences: (ABCG2: F-AAACTTGCTCGGGAACCCTC, R-CTCCAGCTCTATTTTGCATTCC,; GAPDH: F-CTTTGGCATTGTGGAAGGGC, R-TGCAGGGATGATGTTCTGGG; Fasn: F-GCTGCGGAAACTTCAGGAAAT, R–AGAGACGTGTCACTCCTGGACTT; PNPLA2: F-TATCCGGTGGATGAAAGAGC, R-CAGTTCCACCTGCTCAGACA; G6PD: F-CCGGAAACTGGCTGTGCGCT, R–CCAGGTCACCCGATGCACCC, PNPLA3: F-CGAGGCGAGCGGTACGT, R–TGACACCGTGATGGTGGTTT; SREBP-1a: F-GCGCCATGGACGAGCTG, R–TTGGCACCTGGGCTGCT; SREBP-1c: F-GGAGCCATGGATTGCACATT, AGGAAGGCTTCCAGAGAGGA).
9
RNA Extraction from Cell Suspensions
10
RNA Extraction and Purification from Cell Suspensions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell suspensions in TRIzol LS (stored at −80°C) were thawed at room temperature. Chloroform extraction was performed using Phase Lock Gel-Heavy tubes (Quantabio) according to the manufacturer’s protocol. RNA in the aqueous layer was cleaned and concentrated using the RNA Clean and Concentrator Kit (Zymo Research, R1013). The aqueous layer from the chloroform extraction was combined with an equal volume of 100% ethanol and transferred to a Zymo-Spin IC column. Columns were centrifuged for 30 s at 16,000 rcf. Samples 2 and 4 were then treated in-column with DNase I for 15 min (Supplementary Table S1). Samples 1 and 3 were not treated with DNase I. All samples were then washed with 400 µl of Zymo RNA Prep Buffer and centrifuged for 16,000 rcf for 30 s. Columns were washed twice with Zymo RNA Wash Buffer (700 µl, centrifuged for 30 s, followed by 400 µl, centrifuged for 2 min). RNA was eluted by adding 15 µl of DNase/RNase-Free water to the column filter and centrifuging for 30 s. A 2 µl aliquot was submitted for analysis using the Agilent 2100 Bioanalyzer Pico chip to estimate yield and RNA integrity and the remainder was stored at −80°C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!