Mediator production in cell‐free CBMC supernatants was assessed via Bio‐Plex Pro Human 27‐plex immunoassay which measures IL‐1β, IL‐1RA, IL‐2, IL‐4, IL‐5, IL‐6, IL‐7, IL‐8, IL‐9, IL‐10, IL‐12p70, IL‐13, IL‐15, IL‐17, IFNγ, TNF, FGF‐2, G‐CSF, GM‐CSF, PDGF‐BB, VEGF‐A, CCL2, CCL3, CCL4, CCL5, CCL11, and CXCL10 (BioRad) and CXCL10, IL‐1Ra, VEGF (BioRad), IFNγ, and IFNα (eBioscience) Simplex assays. Samples were read using a Bio‐Plex 200 system (BioRad) and analyzed with Bio‐Plex Manager 6.0 software (BioRad). For statistical analysis, samples at or below the limit of detection were assigned the limit of detection value for the assay. Levels of pre‐formed, cell‐associated mediators were determined from freeze‐thaw lysates of CBMC. ELISA using commercial, matched antibody pairs was used to measure CCL8 (R&D Systems, Minneapolis, MN), CXCL9 and CXCL11 (both Peprotech).
Vegf a
Manufactured by Bio-Rad
Sourced in United States
VEGF-A is a growth factor protein that promotes the formation of new blood vessels. It is commonly used in biological research applications to study angiogenesis and blood vessel development.
Automatically generated - may contain errors
Lab products found in correlation
Vascular endothelial growth factor (vegf), by Bio-Rad (2 mentions)
Bicinchoninic acid assay, by Thermo Fisher Scientific (2 mentions)
Cxcl9, by Thermo Fisher Scientific (1 mentions)
Cxcl10, by Bio-Rad (1 mentions)
Cxcl11, by Thermo Fisher Scientific (1 mentions)
Bio plex 200 system, by Bio-Rad (1 mentions)
Bio plex manager 6, by Bio-Rad (1 mentions)
Huvecs, by Merck Group (1 mentions)
Lithium phenyl 2 4 6 trimethylbenzoylphosphinate lap, by Merck Group (1 mentions)
Matrigel, by Thermo Fisher Scientific (1 mentions)
Fitc bsa, by Merck Group (1 mentions)
Sylgard 184, by Thermo Fisher Scientific (1 mentions)
Dulbecco s phosphate buffered saline dpbs, by Thermo Fisher Scientific (1 mentions)
Huvecs, by Lonza (1 mentions)
Tnf α, by Bio-Rad (1 mentions)
Mip 1β, by Bio-Rad (1 mentions)
Ip 10, by Bio-Rad (1 mentions)
Rantes, by Bio-Rad (1 mentions)
Pdgf bb, by Bio-Rad (1 mentions)
High pure rna isolation kit, by Transgene (1 mentions)
6 protocols using vegf a
1
Multiplex Cytokine Profiling of CBMC Supernatants
2
GelMA Hydrogel for HUVEC Migration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GelMA with medium degree of methacrylation was purchased from Allevi (Cat: GMA) while Lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP) was obtained from Sigma (Cat: 900889) to be used as the photo-initiator. Recombinant human vascular endothelial growth factor A (VEGF-A, Bio-Rad, Cat: PHP293) was used for the in vitro scratch assay on human umbilical vein endothelial cells (HUVECs, Sigma, Cat: 200P–05 N). For culturing HUVECs, endothelial cell growth medium was obtained from Lonza (Cat: CC-3124) while Dulbecco's phosphate-buffered saline (DPBS, Gibco) was purchased from ThermoFisher Scientific. Matrigel was obtained from Fisher Scientific (Corning, Cat: CB40234) and used in the scratch assay. Rhodamine B (Rho-B, Sigma, Cat: R6626) and bovine serum albumin fluorescein isothiocyanate conjugate (BSA-FITC, Sigma, Cat: A9771) were implemented for assessment of release profile. Polydimethylsiloxane (PDMS) was purchased from Fisher Scientific (Sylgard 184, Cat: NC9285739).
3
Cytokine Profile of IL-17 and TNF-α Treated HDMECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HDMECs were starved in EBM supplemented with 2% fetal bovine serum for 6 hours and then untreated or treated with 10 ng/ml IL-17 or TNF-α or both in EBM plus 2% fetal bovine serum for 24 hours. Conditioned medium was collected and analyzed by means of xMAP technology using a X200 Luminex platform (Bio-Plex) equipped with a magnetic workstation. Panel used was the PRO Human Cytokine 27-PLEX for the simultaneous detection of FGF basic, Eotaxin, G-CSF, GM-CSF, IFN-γ, IL-1β, IL-1ra, IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12 (p70), IL-13, IL-15, IL-17A, IP-10, MCP-1 (MCAF), MIP-1α, MIP-1β, PDGF-BB, RANTES, TNF-α, and VEGF-A (BioRad) according to the manufacturer's instruction. Data were analyzed using Bio-Plex Software Manager 6.1. Duplicate wells were used for each condition. Coefficient of variation (CV) of measurements of the whole panel was always lower than 10%.
4
Gene Expression Analysis of Transfected EPCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EPCs were transfected with SPION/PEG‐PEI/plasmid (C‐V, CXCR4, VEGFa, Vector) under optimized transfection conditions. RT‐qPCR was performed at 48 h after transfection according to the method. Total RNA was extracted with the high pure RNA isolation kit (TransGen). RT‐qPCR was carried out by the routine three‐step method. cDNA products were amplified by the following primer pair for target gene coding sequence. The CXCR4 coding sequence: forward, 5‐TCTTCCTGCCCACCATCTACTC‐3 and reverse 5‐GTAGATGACATGGACTGCCTTGC‐3. VEGFa sequence: forward 5′‐ACTTTCTGCTGTCTTGGGTG‐3′ and reverse, 5′‐CTGCATGGTGATGTTGGACT‐3′ Gene expression was analyzed by using the iQ SYBR Green Supermix and iQ5 Real‐Time PCR detection system (Bio‐Rad). The mRNA level of GAPDH gene was measured in each sample as an internal normalization standard.
5
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cultured cells was isolated using TRIzol® reagent (Invitrogen, Karlsruhe, Germany). First-strand cDNA was synthesized from total RNA with ImProm-II Reverse Transcription System (Promega, Mannheim, Germany). Quantitative PCR analyses were performed using the MESA GREEN qPCR MasterMix Plus with MeteorTaq polymerase (Eurogentec, Seraing, Belgium). cDNA for genes of interest was amplified with the PrimePCR™ SYBR® Green Assay using the following cycle conditions: 95 °C for 15 min initial denaturation followed by 40 cycles at 95 °C for 15 s, 60 °C for 30 s, and 70 °C for 30 s using the following primers: IL-6 (qHsaCID0020314, IL6, human), VEGF (qHsaCED0043454, VEGFA, human), and STC-1 (qHsaCID0006115, STC1, human), all from BioRad (Hercules, CA, USA). mRNA expression levels were normalized to the eukaryotic translation elongation factor 1 alpha (EF1α) (forward, 5′-ccccgacacagtagcatttg-3′; reverse, 5′-tgactttccatcccttgaacc-3′) (Biomers, Ulm, Germany). The relative expression levels were determined using the 2−ΔΔCT method and were further normalized to the respective day 0 sample.
6
Quantification and Analysis of VEGFA and PDGFR-β Protein Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein was isolated from U87 cell pellets using 1× radioimmunoprecipitation assay (Thermo Fisher Scientific, USA) lysis buffer containing protease inhibitor. Bicinchoninic acid assay (#23225, Thermo Fisher Scientific, USA) was used to quantify the protein as per the manufacturer’s instructions. A total of 35 μg of total protein was then separated on a precast 4 to 15% polyacrylamide gel using Mini-PROTEAN electrophoresis cell (Bio-Rad, USA). The separated protein samples were transferred to a polyvinylidene fluoride membrane using semidry (for VEGFA) or wet transfer (for PDGFR-β) and blocked with 5% nonfat dry milk in 1× tris-buffered saline (#1706435, Bio-Rad, USA) and 0.1% Tween 20. Primary antibodies, VEGFA [#50661, Cell Signaling Technology (CST), USA], and PDGFR-β (#3169T, CST, USA) were used at 1:250 dilution. Vinculin (#13901T, CST, USA) and β-actin (#8457S, CST, USA) were probed as reference proteins at 1:500 and 1:2000 dilution, respectively. Anti-rabbit immunoglobulin G horseradish peroxidase (HRP)–linked secondary antibody (#7074S, CST) was used at 1:2000 dilution. Blots were then incubated with a chemiluminescent HRP substrate (#WBKLS0500, Millipore, USA) and imaged using ChemiDoc imaging system (Bio-Rad, USA). The band intensities were quantified using ImageJ version 1.51.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!