Quantstudio 3d system

Digital PCR reactions were prepared as follows: 1.5 μL cell lysate, 8.7 μL QuantStudio 3D Digital PCR Master Mix V2 (Thermo Fisher Scientific), 0.87 μL RNaseP reference assay (Thermo Fisher Scientific), 0.87 μL mNG2_1-10 or AmpR assay (prepared as described above), and 5.46 μL water. The amount of lysate was calculated based on the number of cells used and the dynamic range of the QuantStudio 3D system (400–4000 copies/μL), and input lysate volumes were adjusted as needed to obtain data within this dynamic range. 14.5 μL of the reaction mix was loaded onto dPCR chips using the QuantStudio 3D Digital PCR 20 K Chip Kit V2 (Thermo Fisher Scientific), taken through PCR thermocycling and analyzed on the QuantStudio 3D system (Thermo Fisher Scientific) according to manufacturer’s instructions. Data was analyzed using the QuantStudio 3D AnalysisSuite Cloud Software (Thermo Fisher Scientific).

Total RNA was isolated from LC tissue specimens, A549 and PC9 cells using RNA extraction reagent (TRIzol, Invitrogen, USA). The purity and concentration of the obtained total RNA were determined, and then the generation of cDNA templates was initiated using the HiFiScript cDNA synthesis kit (CWBIO, China). Next, PCR kits with specific primers (SYBR Green Master Mix, Applied Biosystems) and QuantStudio 3D system (Thermo Fisher, USA) were employed to complete the remaining RT-qPCR steps. The levels of both METTL3 and TFRC were fully normalized to β-actin. The relative expression levels of target genes in treated cells were calculated by the 2^–∆∆Ct method. The primer sequences of the specific genes used were:
METTL3-F: 5′-AAGCTGCACTTCAGACGAAT-3′
METTL3-R: 5′-GGAATCACCTCCGACACTC-3′
TFRC-F: 5′-ACCTGTCCAGACAATCTCCAG-3′
TFRC-R: 5′-TGTTTTCCAGTCAGAGGGACA-3′
β-Actin-F: 5′-TGAGAGGGAAATCGTGCGTGAC-3′
β-Actin-R: 5′-AAGAAGGAAGGCTGGAAAAGAG-3′

Samples of MKN45 and MKN45/5FU cells, as well as primary OX tumors in the stomach and metastatic OX tumors of the liver that were macroscopically and clearly distinguishable from surrounding mouse tissue (>5 mm) were selected for analysis. Template DNA from scraped cell pellets or WAXFREE (TrimGen)-treated ethanol-fixed paraffin-embedded OX tumor materials was extracted with a QIA DNA Mini kit (Qiagen). OX tumors were dissected manually under a microscope to minimize contamination with mouse tissue. The DNA was subjected to digital PCR reactions in a QuantStudio 3D system (Thermo Fisher Scientific) for which the genome copy number was adjusted to approximately 20,000 for each sample. The specific point mutation was detected with TaqMan MGB probes that were specific for the codon 707 mutation (G > A). All procedures strictly followed the manufacturer’s protocol. Primer and probe sequences for codon 707 were: PIK3CA-codon707F (Forward primer), GGGATGTATTTGAAGCACCTGAAT; PIK3CA-codon707R (Reverse primer), CTGCAGTGAAAAGAGTCTCAAACAC. TaqMan MBG probes (antisense probe): PIK3CA-G-probe (wild type), FAM-ATTGCCTCGACTTGC; and PIK3CA-A-probe (mutant type), VIC-CATTGCCTTGACTTGC.

DNA was isolated from 200 μL serum using the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany). To ensure efficient lysis of DNA-bound proteins, serum was subjected to proteinase K digestion at 37°C for 1h. Purified cfDNA was quantified by digital PCR using the QuantStudio 3D System (Thermo Fischer Scientific, Waltham, MA, USA). Allele copies of the TERT locus in plasma DNA were quantified and the DNA amount was calculated based on an external standard reference curve of fragmented genomic DNA. Briefly, 3 μL of purified cfDNA were mixed with 7.25 μL QS3D Master Mix v2, 0.75 μL TaqMan Copy Number Reference Assay TERT (Thermo Fischer Scientific), and 3.5 μl water. Due to the low integrity of cfDNA, genomic DNA (Roche Diagnostics, Mannheim, Germany) of the external standard curve was sheared to the same length in order to compensate for the influence of the DNA integrity on PCR reactions and quantity estimations. The integrity of cfDNA was examined by capillary electrophoresis on a Bioanalyzer 2100 system with the High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA). Approximately 500 pg cfDNA was used for Bioanalyzer analysis. Digital PCR chips were loaded, thermal cycled, and analyzed according to the manufacturer`s instructions.