Plko 1

Manufactured by Genewiz

Sourced in China

The PLKO.1 is a laboratory equipment product designed for DNA cloning and plasmid isolation. It serves as a core tool for genetic engineering and molecular biology workflows. The device operates based on established principles and protocols for plasmid DNA purification, providing researchers with a reliable means of obtaining high-quality plasmid samples for further analysis and experimentation.

Automatically generated - may contain errors

Lab products found in correlation

Hexadimethrine bromide, by Merck Group (1 mentions) Pcdna3, by Genewiz (1 mentions)

2 protocols using plko 1

Knockdown of HNRNPC mRNA in Prostate Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Short hairpin RNAs (shRNAs) targeting HNRNPC mRNA and negative control shRNA were synthesized and cloned into vector PLKO.1 (Genewiz, Suzhou, China). The sequences of shRNAs were listed in

Supplementary Table S1

. Then, using lipoD293 transfection reagent (SignaGene Laboratories, Rockville, USA), PLKO.1, pSPAX2, and pMD2.G plasmids were co-transfected into HEK293T cells following the manufacturer’s protocol. Lentiviral supernatant was collected at 48 and 72 h after transfection. PC-3 and DU145 cells were seeded in 6-well plates and cultured to 30–50% confluence at transfection. The lentiviral supernatant was mixed with the complete medium in a 1:1 ratio and added to the cells with 10 μg/mL hexadimethrine bromide (Sigma-Aldrich, St. Louis, USA) for 24 hours of infection. Then, 72 hours later, 3 μg/mL puromycin was added into the medium to wipe out non-infected cells.

Wang S., Xu G., Chao F., Zhang C., Han D, & Chen G. (2021). HNRNPC Promotes Proliferation, Metastasis and Predicts Prognosis in Prostate Cancer. Cancer Management and Research, 13, 7263-7276.

+ Open protocol

+ Expand

Generation and Characterization of ARHGAP5-AS1 Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human ARHGAP5‐AS1 cDNA (NR_027263.1) with a tag sequence (5’‐GTCGTATCCAGTGCGAATACCTCGGACCCTGCACTGGATACGAC‐3’) at the RNA 3’‐end was synthesised and cloned into pcDNA3.1 by Genewiz (Suzhou, China), which was named as WT. Mutants 1, 2 and 3 are plasmids with the A‐to‐G mutation at the 876, 890 or 928 base of WT. The full‐length ARHGAP5‐AS1 cDNA was also cloned into pCDH‐CMV‐MCS‐EF1α‐Puro. As a result, the resultant plasmid was designated A‐AS1. The full‐length ARHGAP5‐AS1 cDNA with inserted T7 promoter upstream and downstream from the cloning site was also cloned into pcDNA3.1. The resultant plasmid was designated pcDNA‐A‐AS1. Two ARHGAP5‐AS1 shRNAs (shA‐AS1‐1 or shA‐AS1‐2, respectively) or the negative control shRNA (shNC) (Table S3) were synthesised and cloned into pLKO.1 by Genewiz (Table S3). These plasmids were named shA‐AS1‐1, shA‐AS1‐2 or shNC. The cDNA for the HA‐tagged CSDE1 (NM_007158.6) and truncated versions of HA‐tagged CSDE1 were cloned into pcDNA3.1 (Genewiz, China). To guarantee the orientation and integrity of plasmids, Sanger sequencing was performed.

Liu J., Zhang N., Zeng J., Wang T., Shen Y., Ma C, & Yang M. (2022). N6‐methyladenosine‐modified lncRNA ARHGAP5‐AS1 stabilises CSDE1 and coordinates oncogenic RNA regulons in hepatocellular carcinoma. Clinical and Translational Medicine, 12(11), e1107.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!