Qscript cdna supermix

Recombinant hCMEC/D3 cell lines (1 × 10⁶ cells/ml) expressing either LXRα shRNA, LXRβ shRNA, or non-targeting shRNA were seeded in 24-well plates in growth medium. Upon confluency, cells were treated with DMSO (VWR, Leuven, Belgium) or with 5 ng/ml TNFα and 5 ng/ml IFNγ (Peprotech, London, UK) for 24 h. EAE animals were sacrificed on day 23 post-adoptive transfer or day 36 post-immunization. Spinal cords were isolated and snap frozen in liquid nitrogen. Total RNA from cultures and tissues was extracted using Qiazol (Qiagen, Venlo, The Netherlands) and the RNeasy mini kit (Qiagen), according to the manufacturer's instructions. RNA concentration and purity were determined with a NanoDrop spectrophotometer (Isogen Life Science, De Meern, The Netherlands). cDNA was synthesized using qScriptTM cDNA SuperMix (Quanta Biosciences, VWR), following manufacturer's guidelines. qRT-PCR was carried out using SYBR green master mix (Applied Biosystems, Waltham, MA) and a Step One Plus detection system (Applied Biosystems). Primers used for qRT-PCR are shown in Table S1. Relative quantitation of gene expression was accomplished using the comparative Ct method. Data were normalized to the most stable reference genes, as previously described (19 (link)).

Following 4 months of Western diet feeding, RNA was isolated from the proximal portion of the intestines (duodenum) of gonadectomized XX and XY male and female Ldlr^−/− mice (n = 4–5 mice/group) and 1 µg of RNA were reverse transcribed to complementary DNA using the qScript^TM cDNA Supermix (Quanta Biosciences, cat# 95048–500). mRNA abundance was measured by real-time PCR using SYBER Green FastMix (Quanta Biosciences, cat# 95071–012) on a BioRad quantitative real-time PCR thermocycler. Sequences for primers for RT-PCR are in Supplementary Table 1. mRNA abundance was quantified as a fold change using the ΔΔCt method and normalized to the average of the 3 least variable housekeeping genes (beta-actin, glyceraldehyde 3-phosphate dehydrogenase, and beta-2-microglobulin).

Total RNA was isolated with Qiazol (Qiagen, Venlo, The Netherlands) and the RNeasy mini kit (Qiagen), according to the manufacturer’s guidelines. A NanoDrop spectrophotometer (Isogen Life Science, De Meern, The Netherlands) was used to determine RNA concentration and purity. RNA was reverse-transcribed using qScriptTM cDNA SuperMix (Quanta Biosciences, VWR, Leuven, Belgium) according to the manufacturer’s instructions. RT-qPCR was conducted on a Step One Plus detection system (Applied biosystems, Foster City, CA, USA). Cycle conditions were 95 °C for 20 s, followed by 40 cycles of 95 °C for 3 s, and 60 °C for 30 s. The PCR reaction mixture contained SYBR green master mix (Thermo Fisher Scientific), 0.3 μM forward and reverse primer (IDT technologies, Leuven, Belgium), RNase free water, and 12.5 ng cDNA template in a total reaction volume of 10 μL. Relative quantitation of gene expression was accomplished using the comparative Ct method. Data were normalized to the most stable reference genes. Primers used for RT-qPCR are shown in Supplementary Table S2.

C57BL/6 mice were euthanized by cervical dislocation and the eyes were immediately enucleated. For each mouse, the eyes were dissected in 2× PBS and the retina obtained was used for mRNA isolation using RNAzol® RT (Molecular Research Center, Inc.), as per the manufacturer's instructions. Using the C1000 Touch Thermal Cycler (Bio-Rad) and qScript^TM cDNA Supermix (Quanta BioSciences), 1 μg of mRNA was reverse transcribed to complementary DNA (cDNA), according to the manufacturer's instructions. The appropriate master mixtures were prepared using PrecisionFAST 2× qPCR Master Mix (with SYBR Green and low ROX) (Primerdesign), qRT-PCR primers, and nuclease-free water (Hyclone) for qRT-PCR and the experiment was conducted using a QuantStudio^TM 6 Flex Real-time PCR System (Thermo Fisher Scientific). The expression of Cavin-2 was obtained by normalizing to GAPDH. Nucleotide sequences of primers (mouse) used in qRT-PCR are the following: Cavin-2 (forward, TTGTGAAGGAGCCAGTTCCC; reverse, TCAGAGGAGAGGTCCACGTT) and Gapdh (forward, AGGTCGGTGTGAACGGATTTG; reverse, TGTAGACCATGTAGTTGAGGTCA).

RNA was purified using TRIzol (Life Technologies, Carlsbad, CA; US)/chloroform ultrapure (Applichem, Darmstadt, Germany) and RNeasy Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. cDNA was prepared using qScriptTM cDNA SuperMix (Quanta BioSciences, Gaithersburg, Maryland, US) according to the manufacturer’s instructions. PCR was performed using Quanti fast SYBR green (Qiagen). Samples were run in duplicates on the LightCycler® 480 System (Roche, Basel, Switzerland) and values were calculated in relation to housekeeping gene GAPDH.

The fibrin constructs were lysed on the selected day, and messenger RNA (mRNA) was isolated using the NucleoSpin RNA II Kit (Machery Nagel, Düren, Germany) with some modifications. To ensure efficient cell lysis, fibrin gels were disintegrated by a sterile type 11 Cutfix^® scalpel (Carl Roth GmbH & Co. KG, Karlsruhe, Germany) and submerged into the lysis buffer; they were kept at −20 °C until frozen. Then, the gels were thawed and pipetted up and down rigorously. The isolated mRNA was transcribed to complementary DNA (cDNA) using qScriptTM cDNA SuperMix (Quanta Biosciences, Gaithersburg, MD, USA) on Mastercycler EP Gradient S (Eppendorf, Hamburg, Germany). The gene expression was measured using SYBRTM Green PCR Master Mix (Applied Biosystems GmbH, Darmstadt, Germany) on LightCycler 480 II (Roche Diagnostics GmbH, Mannheim, Germany). The primers were designed using Primer3 Input software version 0.4.0 (Whitehead Institute for Biomedical Research, Cambridge, MA, USA) and produced by TIB Molbiol (Berlin, Germany). The expression of all target genes was normalized to the expression of a housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primer sequences are summarized in Table 2.