Pcmv6 empty vector

All Zdhhc and PLCβ1 siRNA were purchased from Santa Cruz Biotech. pCMV6 empty vector, and ZDHHC21 plasmids were purchased from Origene; and pLX304 empty vector and PLCβ1 plasmids were purchased from Genecopoeia. MLMVECs grown to 90% confluence were trypsinized, pelleted, and resuspended in 100 μl of P5 Primary Cell 4D-Nucleofector^TM X with 1 μM siRNA or 2 μg plasmid. Cells were rapidly electroporated using the 4D-Nucleofector^TM System (Lonza, MD, USA) and plated in Endothelial cell complete medium (Cell Biologics) for experiments. Mutation at potential palmitoylation site of PLCβ1 was created by mutagenesis using as template the pLX304 with PLCβ1 transcript variant 1 cDNA clone purchased from Genecopoeia; and the Q5 Site-Directed Mutagenesis Kit with supplied 5-alpha competent cells purchased from New England BioLabs. PLCβ1 C17S mutagenesis primers (Fw: 5′ AAGCCCGTGTCCGTGTCCGAC 3′; Rev: 5′ GAGTTGCAAGGCGTGCAC 3′) were designed using the NEBaseChanger tool also provided by New England BioLabs. Successful mutation of C17S was confirmed by sequencing using (Fw: 5′ ACATCAATGGGCGTGGATAG 3′; Rev 5′ GGAAAGCCACGAGATTCAAATG 3′) designed with the PrimerQuest tool provided by Integrated DNA Technologies and Sanger sequencing of PCR product provided by Genewiz.

Breast cancer cell lines, including MDA-MB-453, MDA-MB-468, BT474, BT549, T47D, MCF7, SK-BR-3, and the human normal breast cell line (MCF-10A), were obtained from American Type Culture Collection. BC cells were cultured using the RPMI-1640 supplied with 10% (v/v) fetal bovine serum (FBS). MCF-10A cells were cultured in DMEM/F12 medium supplemented with 10% (v/v) fetal bovine serum (FBS), 20 ng/ml EGF, 0.5 mg/ml hydrocortisone, 10 μg/ml insulin, and 100 ng/ml cholera toxin.
The Ajuba plasmid and the corresponding negative pCMV6 empty vector were from Origene company and transfected into cells using Lipofectamine 3000. Ajuba specific siRNA was from Dharmacon and transfected using the Dharmafect1 reagent. All transfection procedures were conducted following the manufacturer's protocol.

pCMV6 empty vector (#PS-100001) and Myc/DDK-pCMV6-ZNF326 (#RC-210339) were purchased from Origene (Rockville, MD, USA). pcDNA3.1 empty vector (#52535), pcDNA3.1-FLAG-HDAC7 (#13824), TCF4 plasmid (#16512), pEGFP-N1 empty vector (#86776), pEGFP-N1-β-catenin (#71367) and Super8 × TOPflash (#12456) were purchased from Addgene (Cambridge, MA, USA). pRL-TK (#E2241) was purchased from Promega (Madison, Wisconsin, USA). Control siRNA (sc-37,007), siRNA-ZNF326 (sc-88,338) and siRNA-HDAC7 (sc-35,546) were purchased from Santa Cruz Technology. The nucleotide sequence shRNA-ZNF326 was provided by Dr. Roberto Rangel and Professor Nancy A. Jenkins at the Anderson Cancer Center of the US. ShRNA-ZNF326, shRNA-HDAC7 plasmid and the lentivirus envelope shZNF326/ZNF326 were constructed by Genechem company (Shanghai, China). The mutants ZNF326-△TAD, ZNF326-△Zn1, ZNF326-△Zn2 and ZNF326-△TAD&△Zn1 + 2 were also constructed by Genechem. HA-CBP plasmid is a gift from Prof. Liu Cao (Department of Translational Medicine, China Medical University). Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) transfection reagent was used for plasmid transfection. Puromycin (Sigma-Aldrich, St. Louis, MO, USA) was used to select stably transfected cells.

pCMV6-JMJD8 plasmids were purchased from Taihe Biotechnology (Beijing, China), and pCMV6 empty vector was purchased from Origene (Rockville, MD, USA). Stable clonal cell lines were selected with G418 (Thermo Fisher Scientific, Waltham, MA, USA). Short interfering RNA (siRNA) targeting JMJD8 and negative control siRNA (NC) were purchased from Ruibo (Guangzhou, China). The siRNA (50 nM) used for the specific targeting of JMJD8 had the following sequence: 5′-GGTACTCAGAAGTGATCTA-3′, according to the instructions, cells were transiently transfected by Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA).
The cells were stimulated with 100 ng/mL EGF (PeproTech, Rocky Hill, NJ, USA) for the indicated time periods after 16 hours of serum starvation, and 1 hour of incubation with cycloheximide (CHX, MedChemExpress, NJ, USA).

HBE, A549, H1299, H292, H460, LK2, and H661 NSCLC cell lines were cultured with Roswell Park Memorial Institute 1640 medium (Gibco, Grand Island, NY, USA) containing 10% calf serum (Invitrogen, Carlsbad, CA, USA). Calu-1 cells were cultured in Mccoy’s 5A medium (Sigma, St. Louis, MO, USA) containing 10% calf serum at 37 °C and 5% CO₂. The pCMV6 empty vector and pCMV6-RASSF7 plasmid were purchased from Origene; pCMV6-RASSF7-Mut, RASSF7 shRNA (RASSF7-homo-268, RASSF7-homo-1387, RASSF7-homo-731), and the negative control shRNA were purchased from Shanghai GenePharma (Shanghai, China); YAP siRNA was purchased from Guangzhou RIBOBIO(Guangzhou, China); pGL3b_8×GTIIC-luciferase and pRL-TK plasmids were from Addgene (Cambridge, MA, USA). Lipofectamine 3000 transfection reagent (Invitrogen) was used for cell transfections. Semi-stably transfected cell lines were screened for four weeks with G418.

A2780 cells were transfected with a pCMV6 empty vector or pCMV6-EpCAM expression vector (OriGene, Rockville, USA), containing the human EpCAM cDNA, using Lipofectamine 3000 (Invitrogen, Tokyo, Japan) according to the manufacturer's protocol. Transfected cells were selected in a medium with 100 μg/mL ampicillin.