Rneasy lipid tissue

Manufactured by Qiagen

Sourced in Germany

The RNeasy Lipid Tissue Kit is a laboratory product designed for the isolation and purification of total RNA from lipid-rich tissues. It utilizes a silica-membrane-based technology to efficiently capture and purify RNA molecules from the sample, while removing contaminants and inhibitors.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

RNeasy® Lipid Tissue Handbook RNeasy Lipid Tissue Mini Kit RNeasy Lipid Tissue Midi Kit RNeasy Lipid Tissue extraction kit RNeasy Lipid Tissue Mini RNeasy lipid tissue RNA extraction kit RNeasy Mini Kit/RNeasy Lipid Tissue Mini Kit RNeasy Lipid Tissue Kit RNeasy Lipid Tissue Mini Protocol Kit Qiazol RNeasy Lipid Tissue mini kit

8 protocols using rneasy lipid tissue

Extraction and Quantification of RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the RNeasy Kit (Qiagen) according to the manufacturer’s instructions. For isolating RNA from WAT, an RNeasy Lipid Tissue (Qiagen) was used. cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad), and quantitative PCR (qPCR) was performed in triplicates using the SYBR Green PCR Master Mix Kit (Applied Biosystems).

Chitraju C., Walther T.C, & Farese RV J.r. (2019). The triglyceride synthesis enzymes DGAT1 and DGAT2 have distinct and overlapping functions in adipocytes. Journal of Lipid Research, 60(6), 1112-1120.

+ Open protocol

+ Expand

Analyzing Adipogenesis Gene Expression

Cited 5 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was obtained from frozen tissues, as previously described [36 (link)], using RNeasy Lipid Tissue (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Gene expression analysis levels were determined using the relative expression method with the threshold crossing point (Ct-value), as described [26 (link),30 (link),37 (link)].
PCR arrays for the RT² Profiler™ PCR Array Mouse Adipogenesis (Qiagen, product no. 330,231 and Cat. No. PAMM-049Z) were performed following the manufacturers’ protocol. Gene expression levels were calculated using the ΔΔCt method after normalization to the housekeeping gene expression and determination of the fold change. Each GeneQuery™ plate contains eight controls, five target housekeeping genes (β-actin, GAPDH, LDHA, NONO, and PPIH), and genes encoding for pre-adipocyte cell markers, proliferation, differentiation and adipogenesis, lipid metabolism, and obesity. Gene expression is presented as the log10 of mean values (n = 3 in each group), as previously described [26 (link),40 (link),41 ] (https://CRAN.R-project.org/package=gplots, accessed on 4 March 2022).

Waldman M., Singh S.P., Shen H.H., Alex R., Rezzani R., Favero G., Hochhauser E., Kornowski R., Arad M, & Peterson S.J. (2022). Silencing the Adipocytokine NOV: A Novel Approach to Reversing Oxidative Stress-Induced Cardiometabolic Dysfunction. Cells, 11(19), 3060.

+ Open protocol

+ Expand

RNA Extraction from Adipose and Muscle

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from WAT and the gastrocnemius muscle using RNeasy Lipid Tissue and RNeasy Plus Universal Mini Kits (QIAGEN, Valencia, CA, USA) according to manufacturer’s instructions. Total RNA was extracted from skeletal muscle myocytes using RNAiso and amplified using CellAmp Whole Transcriptome Amplification Kit Version 2 (Takara Bio Inc., Shiga, Japan).

Tsutsumi R., Yoshida T., Nii Y., Okahisa N., Iwata S., Tsukayama M., Hashimoto R., Taniguchi Y., Sakaue H., Hosaka T., Shuto E, & Sakai T. (2014). Sudachitin, a polymethoxylated flavone, improves glucose and lipid metabolism by increasing mitochondrial biogenesis in skeletal muscle. Nutrition & Metabolism, 11, 32.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis in Adipose Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 3T3 cells using TRIzol® (Ambion, Austin, TX) and from frozen adipose tissue by RNeasy® Lipid Tissue (Qiagen), as per instructions provided by the manufacturers. RNA was determined by measuring the absorbance at 260 nm (A260) with a Biotek™ plate reader and the Take3™ plate (Biotek, Winooski, VT), and assessed by the A260/A280 ratio. cDNA was synthesized from total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems), after real-time PCR was performed using TaqMan® Fast Universal Master Mix (2x), on a 7500 HT Fast Real-Time PCR System (Applied Biosystems). Specific TaqMan Gene Expression Assays probes for mouse HO-1, PGC1α, UCP1, COX-IV (cytochrome c oxidase subunit-IV), adiponectin, TNFα, IL-6, Mfn1, Mfn2, Drp1, Fis1, OPA1, aP2, SIRT3, C/EBPα, and GAPDH were used as previously described [33 (link)].

Singh S.P., Bellner L., Vanella L., Cao J., Falck J.R., Kappas A, & Abraham N.G. (2016). Downregulation of PGC-1α Prevents the Beneficial Effect of EET-Heme Oxygenase-1 on Mitochondrial Integrity and Associated Metabolic Function in Obese Mice. Journal of Nutrition and Metabolism, 2016, 9039754.

+ Open protocol

+ Expand

Quantitative RT-PCR of Inflammatory Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the commercial kits RNeasy Plus (QIAGEN, Valencia, CA) for liver and RNeasy Lipid Tissue (QIAGEN) for white adipose tissue. Reverse transcription with 1 μg of RNA was carried out in an Eppendorf Mastercycler (Hamburg, Germany) using a high capacity cDNA reverse transcription kit (ABI, Foster City, CA). Primer annealing was done at 25°C for 10 min, followed by elongation at 37°C for 2 h and inactivation of the enzyme at 85°C for 5 min. Negative controls (no added transcriptase) were performed in parallel. qRT-PCR for the genes Cd68, Ly6g, tumor necrosis factor (Tnf), interleukin-1β (Il1b), interleukin-1α (Il1a), interferonγ (Ifng), and glyceraldehyde 3-phosphate dehydrogenase (Gapdh) was performed in triplicate in a 7500 Fast Real-Time PCR System (ABI). The primers in Table 1 were employed and purchased from Integrated DNA Technologies (Coralville, IA). qRT-PCR was carried out using Power SYBR Green Master Mix (ABI). Taq polymerase was activated at 95°C for 10 min. The cycling parameters were denaturation at 95°C for 30 sec and extension at 60°C for 1 min (for 40 cycles). Data analysis was performed using the 2^−ΔΔCT method for relative quantification. All samples were normalized to Gapdh.

Ilyas G., Cingolani F., Zhao E., Tanaka K, & Czaja M.J. (2019). Decreased Macrophage Autophagy Promotes Liver Injury and Inflammation from Alcohol. Alcoholism, clinical and experimental research, 43(7), 1403-1413.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis of Hypothalamic Samples

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from the hypothalamus (RNeasy^® Lipid Tissue, Qiagen, Hilden, Germany). Quantitative polymerase chain reaction (RT-qPCR) was performed using exon–exon boundary-spanning primer sequences (see below) and the SYBR Green methodology on a Step One Plus sequence amplification system (Applied Biosystems, Foster City, CA, USA). The relative mRNA expression of the tested gene normalized to Gapdh expression was calculated using the ΔΔCt method.
The primers were as follows: Negr1 forward/reverse: ATGTGACGCAGGAGCACTT/CCATACTGGGCTGTACTTGGA [85 (link)]; Lsamp forward/reverse ATCACCAGGGAACAGTCAGG/TCCCGGTACCACTCAAAGTC [67 (link)]; Adam10 (QT00106351, Qiagen, Hilden, Germany).

Rödig N., Sellmann K., dos Santos Guilherme M., Nguyen V.T., Cleppien D., Stroh A., May-Simera H.L, & Endres K. (2022). Behavioral Phenotyping of Bbs6 and Bbs8 Knockout Mice Reveals Major Alterations in Communication and Anxiety. International Journal of Molecular Sciences, 23(23), 14506.

+ Open protocol

+ Expand

Quantifying Gene Expression in Adipose Tissue

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of adipose tissue was obtained using RNeasy lipid tissue (Qiagen, Hilden, Germany). cDna was synthesized using a high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Waltham, MA, USA). PCRs were performed with a Bio-Rad CFX96 Connect real-time PCR system instrument and software (Bio-Rad Laboratories srl, Milan, Italy), as previously reported [21 (link)]. Each cDNA sample (500 ng) was mixed with 2× QuantiTech SYBRGreen PCR Master Mix (Qiagen, Hilden, Germany,) and validated primers (Appendix A, Table A1). Data were normalized to Actb for BAT and Rn18S for scWAT as a housekeeping gene, and the data were analyzed according to 2^−ΔΔCt method.

Annunziata C., Pirozzi C., Lama A., Senzacqua M., Comella F., Bordin A., Monnolo A., Pelagalli A., Ferrante M.C., Mollica M.P., Iossa A., De Falco E., Mattace Raso G., Cinti S., Giordano A, & Meli R. (2022). Palmitoylethanolamide Promotes White-to-Beige Conversion and Metabolic Reprogramming of Adipocytes: Contribution of PPAR-α. Pharmaceutics, 14(2), 338.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from WAT specimens (300 mg) using RNeasy Lipid tissue (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations. Total RNA from samples obtained in in vitro experiments was extracted using NucleoSpin RNA II kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions. RNA concentration as well as purity was measured using a Nanodrop ND-1000 Spectrophotometer (Thermo Fisher Scientific) and high quality RNA was confirmed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). Reverse transcription was performed using the iScript cDNA synthesis kit (Qiagen) and random hexamer primers (Invitrogen, Carlsbad, CA). Quantitative real-time PCR was performed using commercial TaqMan probes (Applied Biosystems). Gene expression was normalized to the internal reference gene LRP10. Relative expression was calculated using the 2[-Delta Delta C(T)] method [21 (link)].

Kulyté A., Ehrlund A., Arner P, & Dahlman I. (2017). Global transcriptome profiling identifies KLF15 and SLC25A10 as modifiers of adipocytes insulin sensitivity in obese women. PLoS ONE, 12(6), e0178485.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!