Paired-end RNA-sequencing was performed using 1 µg RNA and two samples per lane to achieve maximum sequencing depth. The genomics unit performed the quality control and library preparation. The libraries were sequenced using Illumina HiSeq2000 sequencer. Genes with a fold-change of 1.5 were considered to be differentially expressed.
Sybr green 1 pcr master mix
SYBR Green I PCR Master Mix is a ready-to-use solution that contains all the necessary components for real-time PCR reactions, including SYBR Green I dye, DNA polymerase, nucleotides, and buffer. It is designed to facilitate the quantification of DNA or RNA targets by real-time PCR.
Lab products found in correlation
21 protocols using sybr green 1 pcr master mix
Transcriptome Analysis of Gene Expression
Paired-end RNA-sequencing was performed using 1 µg RNA and two samples per lane to achieve maximum sequencing depth. The genomics unit performed the quality control and library preparation. The libraries were sequenced using Illumina HiSeq2000 sequencer. Genes with a fold-change of 1.5 were considered to be differentially expressed.
Quantitative PCR Analysis of mitfa Expression
Validating miRNA Expression via Stem-Loop RT-qPCR
Quantifying Gene Expression with Real-Time PCR
Gene Expression Quantification by RT-PCR
Quantification of Cytokine mRNA Levels
Real-Time qPCR Analysis of Zebrafish Genes
gapdh: forward 5′ACCAACTGCCTGGCTCCT3′, reverse 5′TACTTTGCCTACAGCCTTGG3′;
mitfa: forward 5′CTGGACCATGTGGCAAGTTT3′, reverse 5′GAGGTTGTGGTTGTCCTTCT3′.
Quantifying mRNA Expression in Embryos
Gene Expression Analysis by RT-qPCR and RNA-seq
Quantitative Analysis of Gene Expression in HCC
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!