Anti ifn γ antibody

Naive splenocytes were isolated from 6-8-wk-old C57BL/6 OX40-Cre HuR^fl/fl knockout mice or C57BL/6 HuR^fl/fl control mice. CD4⁺ T cells were isolated using CD4 (L3T4) MicroBeads (Miltenyi Biotec) following the manufacturer’s protocol. Cells were activated with anti-CD3 anti-CD28 (5 μg/ml each) for 5 days in T cell media (DMEM, 10% FCS, 50ug/ml gentamicin, 1mM Na Pyruvate, 2mM L-Glutamine and 0.05mM beta-mercaptoethanol (2-BME). For Th2 polarizing condition 100 U/ml rIL-4, 50 U/ml rIL-2, and 10 μg/ml anti–IFN-γ Ab were added in the media upon activation. Anti-CD3, anti-CD28, anti-IL-4, and anti- IFN-γ antibodies were purchased from eBioscience (San Diego, CA). Cytokines were all purchased from Peprotech (Rocky Hill, NJ). Tissue culture reagents were all purchased from Life Technologies.

Naive CD4⁺CD62L⁺ T cells (purity of cells >95%) were purified from the spleens of DBA/1 mice using a CD4⁺CD62L⁺ T Cell Isolation Kit II (Miltenyi Biotec, Bergisch Gladbach, Germany) and cultured in RPMI 1640 medium supplemented with 10% FBS, 100 IU/ml penicillin and 100 mg/ml streptomycin. To induce Th17 polarization, the purified cells were stimulated with plate-bound anti-CD3 antibodies (eBioscience, San Diego, CA, USA, 2 μg/ml), anti-CD28 antibodies (eBioscience, 2 μg/ml), TGF-β (2 ng/ml), IL-6 (20 ng/ml), anti-IFN-γ antibodies (10 μg/ml) and anti-IL-4 antibodies (10 μg/ml), with or without silibinin (0, 50, and 100 μM), for 72 h. All reagents were from PeproTech (Rocky Hill, NJ, USA). Activated cells were restimulated with PMA (20 ng/ml, Sigma-Aldrich) and ionomycin (500 ng/ml, Sigma-Aldrich) in the presence of brefeldin A (10 μg/ml) for 5 h before intracellular staining was performed. Cells were stained with phycoerythrin-conjugated anti-mouse IL-17 antibodies (BD Biosciences) and measured by flow cytometry.

The Tetramer Facility of National Institutes of Health (NIH) provided LCMV-GP33 tetramer. Cells were stained with allophycocyanin (APC)-labeled GP33 MHC class I tetramer (GP33/H-2Db) for 15 minutes at 37 °C. After incubation, the samples were stained with anti-CD8 (clone 53–6.7; eBioscience) or anti-CD4 (clone GK1.5; eBioscience) antibodies for 30 minutes at 4 °C. Absolute numbers of GP33-specific CD8⁺ T cells were calculated with fluorescent beads (BD Biosciences) by using fluorescence-activated cell sorting (FACS). For measurement of intracellular IFN-γ, cells were fixed with 2% formaldehyde in PBS for 10 minutes, permeabilized with 1% saponin in FACS buffer at room temperature, and stained with anti–IFN-γ antibody for 30 minutes at 4 °C (clone XMG1.2; eBioscience). All stained cells were analysed with a FACSFortessa (BD Biosciences) flow cytometer, and data were analysed with FlowJo software.

PBMCs were isolated from peripheral blood using Ficoll density-gradient centrifugation. Naïve CD4⁺T cells were purified from PBMCs according to the manufacturer’s instruction (Miltenyi Biotec, Bergisch Gladbach, Germany). These purified naïve CD4⁺T cells (1 × 10⁶/well) were differentiated into Tfh cells under Tfh cell-polarizing condition (3 μg/ml soluble anti-CD3/28 (eBioscience, San Diego, CA, USA), 50 ng/ml recombinant IL-6 (rIL-6, PeproTech Inc, Rocky Hill, NJ, USA), 50 ng/ml rIL-21 (Abcam, Cambridge, MA, USA), 10 μg/ml anti-IL-4 antibody (eBioscience), 10 μg/ml anti-IFNγ antibody (eBioscience) and 10 μg/ml anti-TGF-β antibody (R&D, Minneapolis, MN, USA)) for 3 days. After initial culture, these differentiating Tfh cells were washed with PBS for 2 times and further expanded alone or cocultured with UC-MSCs (1 × 10⁵/well) in the presence of 3 μg/ml soluble anti-CD3/28 for another 2 days. To detect the factors involved in UC-MSCs-mediated suppression, UC-MSCs were collected after 2 days’ coculture with differentiating Tfh cells and then were fixed by Trizol. Furthermore, 100 μM 1-methyl-DL-tryptophan (1-MT, Sigma), the inhibitor of IDO enzyme activity or 10 μg/ml anti-IL-10 antibody (eBioscience) or 10 μg/ml anti-HLA-G antibody (Biolegend, San Diego, CA, USA) was added to the MSCs-Tfh cells coculture system to block their effects on Tfh cells.

After isolation, the purified CD4⁺ T cells from AVMC patients were transferred into 1640 medium with 10% FBS at a density of 3 × 10⁶ cells /mL in a 12-well culture plate (Corning) and cultured at 37°C/5% CO₂. They were transfected with 200 nM siRNA-Nup98 (IBS company, sense: GGAUGACCGAGAAGAAAUAGA, antisense: UAUUUCUUCUCGGUCAUCCUG) or 4 μg pcDNA3.1-Nup98 plasmid (IBS company) using the Amaxa human T-cell nucleofector kit (Lonza Cologne AG) via V24 program according to the manufacturer's instructions. 4 μg pmaxGFP® Vector was transfected into 3 × 10⁶ CD4⁺ T cells by necleofection. The transfection efficiency was evaluated by flowcytometry. After transfected 12 h, green fluorescent protein (GFP) expression was checked to show the efficiency. The nonsilencing control (NC) siRNA (IBS company, sense: UUCUCCGAACGUGUCACGUTT, antisense: ACGUGACACGUUCG GAGAATT) or empty pcDNA3.1 (IBS company) was transfected into CD4⁺ T cells as control. Cells were then stimulated with 5 × 10⁴ PFU/mL CVB3, 5 μg/mL of anti-CD3 (ebioscience), 2 μg/mL soluble anti-CD28 (eBioscience), 10 μg/mL anti-IL-4 antibody (ebioscience), and 10 μg/mL anti-IFN-γ antibody (ebioscience). After 72 h of incubation, cells and supernatants were collected, respectively, for further study.