DNA samples were the same as those used for SSR genotyping. Concentrations were quantified with Quant‐iT™ PicoGreen™ dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA) and adjusted to 3 ng μL−1. Primers were designed using the reference A. tuberculatus genome.7 The A. tuberculatus complete ALS coding sequence (GenBank: EF157818.1) was used as a query to identify the contig containing the ALS locus in the reference genome with Blast .30 Primers were designed with benchling (https://benchling.com ) to amplify a region of ≈4 kb including the ALS coding sequence (2 kb). Primer sequences are provided in Table S5 . A pool of 36 random samples was used for initial primer tests and PCR optimization. Primers Fw_3 and Rev_4 were chosen because of superior specificity. Ten samples of 96 were amplified with primers Fw_4 and Rev_3 because amplification with Fw_3 and Rev_4 failed. PCR was performed using Phire Hot Start II DNA Polymerase (Thermo Fisher Scientific) in 30‐μL reactions including 6 μL of 5× Phire Green Reaction Buffer, dNTPs mix (0.2 mm each), forward and reverse primers 0.625 μm each, 0.4 μL Phire Hot Start II DNA Polymerase and 9 ng DNA. Amplification conditions: 1 min at 95 °C; 35 cycles of 5 s at 95 °C, 5 s at 60 °C, 60 s at 72 °C; 5 min at 72 °C. A model of ALS gene was obtained with R31 genemodel 32 package.
Phire hot start 2 dna polymerase
Manufactured by Thermo Fisher Scientific
Sourced in United States, Czechia, Finland
Phire Hot Start II DNA Polymerase is a thermostable DNA polymerase enzyme designed for high-fidelity DNA amplification. It exhibits robust performance and is suitable for a variety of PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (18 mentions)
Rneasy mini kit, by Qiagen (5 mentions)
Qiaquick pcr purification kit, by Qiagen (3 mentions)
Superscript 4 kit, by Thermo Fisher Scientific (3 mentions)
Noti enzyme, by Thermo Fisher Scientific (3 mentions)
Q5 hot start high fidelity dna polymerase, by New England Biolabs (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Maxima hot start taq dna polymerase, by Thermo Fisher Scientific (2 mentions)
Clc genomic workbench, by Qiagen (2 mentions)
Qiaquick gel extraction kit, by Qiagen (2 mentions)
Phire reaction buffer, by Thermo Fisher Scientific (2 mentions)
Phusion hot start 2 high fidelity dna polymerase, by Thermo Fisher Scientific (2 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (2 mentions)
Plasmid mini, by A&A Biotechnology (2 mentions)
Phusion polymerase, by Thermo Fisher Scientific (2 mentions)
Ppp master mix, by Top-Bio (2 mentions)
Total rna midi, by A&A Biotechnology (2 mentions)
Taq dna polymerase, by A&A Biotechnology (2 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
Minelute pcr purification kit, by Qiagen (2 mentions)
89 protocols using phire hot start 2 dna polymerase
1
ALS Gene Amplification and Modeling
2
Total RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from EiPSCs and ViPSCs was collected after ten passages (P10) and isolated by standard TRIzol®-chloroform isolation and iso-propanol precipitation. cDNA was derived from the collected mRNA by using SuperScript IV Reverse Transcriptase (SSIV) (ThermoFisher). For RT-PCR 1 μg of RNA and Random Hexamer Primers were used and incubated with SSIV, 0,1 M Dithiothreitol (DTT) and 40 U/μl RNaseOUT (ThermoFisher) for 10 min at 23 °C, 10 min at 50 °C and 10 min at 80 °C. Afterwards samples were stored at −20 °C until further processed. PCR analysis was performed with different primer sets (Tab. S1 ) with Phire Hot Start II DNA Polymerase (ThermoFisher). To perform PCR, a mastermix containing Phire Buffer (ThermoFisher), dNTPs (10 mM) (ThermoFisher) and Phire Hot Start II DNA Polymerase was mixed and divided over different PCR tubes. 1 μl of each primer (10 μM) and 1 μl cDNA was added to the tubes and carefully mixed. Samples were placed in thermocycler (Applied Biosystems™ 2720 Thermal Cycler) and PCR program was initiated (Tab. S2 ).
3
Genotyping Microdeletion Encompassing SGCD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To define the break points of the microdeletion encompassing SGCD exons 7 and 8 and the 3′ intergenic sequence, primers were designed in flanking sequences (Additional file 1 : Table S1).
For genotyping, primer pairs were designed within the deletion to amplify only wild-type alleles, as well as flanking the deletion for amplification of the mutant allele. Primer pairs were multiplexed for amplification using Phire Hot Start II DNA polymerase (ThermoFisher) and products were resolved by gel electrophoresis. Products were initially verified via Sanger sequencing. The multiplex PCR was used to test unrelated Boston terriers and dogs of other breeds.
For genotyping, primer pairs were designed within the deletion to amplify only wild-type alleles, as well as flanking the deletion for amplification of the mutant allele. Primer pairs were multiplexed for amplification using Phire Hot Start II DNA polymerase (ThermoFisher) and products were resolved by gel electrophoresis. Products were initially verified via Sanger sequencing. The multiplex PCR was used to test unrelated Boston terriers and dogs of other breeds.
4
Genomic DNA Extraction and Inverse PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA were isolated in 96-well format from frozen cell pellets, using Epicentre's (Illumina) QuickExtract. Nested Genomic polymerase chain reaction (PCR) in 96-well format was performed using Phire hot start II DNA polymerase from Thermo Scientific (Finnzymes). Primer sequences for the first amplification were oIC129: GTCGCTGTGCATTTAGGACA and oIC131: CAGAAAGCGAAGGAGCAAAG. Second amplification primer sequences were oIC14: CTTCCATTTGTCACGTCCTG and oIC130: GCTTGTCAATGCGGTAAGTG.
To produce inverse PCR (iPCR) templates, 20 μl of genomic DNA were digested with restriction enzyme Csp6I in a final volume of 50 μl, then self-ligated for 2 h at room temperature. Primers for the first iPCR amplification were oIC130 and oIC 269: CGACTGAGATGTCCTAAATGCAC. Second iPCR amplification primer sequences were oIC265: TGTCCTAAATGCACAGCGAC and oIC270: GACCAATTGGAAGACCCAAT. Products were precipitated with polyethylene glycol prior to sequencing as previously described (17 (link)). Fluorescent labeling was performed using BigDye terminator 1.1 (Invitrogen) with sequencing primer oIC106: GGGGAACTTCCTGACTAGGG for regular PCR and oIC263: TTAGAAAGAGAGAGCAATATTTCAAGAATG for iPCR. Sequences were read using Applied Biosystems’ AB3130XL Genetic Analyzer. iPCR products were analyzed using the iMapper software (18 (link)) and the chromosomal map (Figure1D ) was produced using Ensembl (19 (link)).
To produce inverse PCR (iPCR) templates, 20 μl of genomic DNA were digested with restriction enzyme Csp6I in a final volume of 50 μl, then self-ligated for 2 h at room temperature. Primers for the first iPCR amplification were oIC130 and oIC 269: CGACTGAGATGTCCTAAATGCAC. Second iPCR amplification primer sequences were oIC265: TGTCCTAAATGCACAGCGAC and oIC270: GACCAATTGGAAGACCCAAT. Products were precipitated with polyethylene glycol prior to sequencing as previously described (17 (link)). Fluorescent labeling was performed using BigDye terminator 1.1 (Invitrogen) with sequencing primer oIC106: GGGGAACTTCCTGACTAGGG for regular PCR and oIC263: TTAGAAAGAGAGAGCAATATTTCAAGAATG for iPCR. Sequences were read using Applied Biosystems’ AB3130XL Genetic Analyzer. iPCR products were analyzed using the iMapper software (18 (link)) and the chromosomal map (Figure
5
Genotyping RAG1 and RAG2 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequence of RAG1 and RAG2 was amplified using Phire Hot Start II DNA Polymerase (Thermo Fisher Scientific; USA). Allele-specific PCR was used to characterize RAG1 M1V and R737H alleles. Each allele (wild type and mutant form) was amplified separately with an allele-specific primer in combination with a general primer using Maxima Hot Start Taq DNA Polymerase (Thermo Fisher Scientific, USA). The resulting amplicons were purified and custom Sanger sequenced (Eurofins Genomic; Germany). Sequences were aligned to NM_000448.2 RAG1 and NM_001243785.1 RAG2, using CLC Genomic Workbench (QIAGEN, Germany)
6
Salivary Gland RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from five pairs of salivary glands of third instar females, reverse-transcribed with iScript Reverse Transcription Supermix (Bio-Rad, Hercules, CA), treated with RNAse-free DNase I (New England Biolabs, Beverly, MA), and analyzed by PCR with Phire Hot Start II DNA Polymerase (Thermo Fisher scientific). The PCR primers used are listed in Table S3 in File S1 .
7
CLN3 Expression Plasmid Construction
8
Molecular Cloning and Transformation Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard molecular biology protocols were used in this study (Sambrook and Russell 2001 ). All oligonucleotides used here are listed in Supplementary Table S1 C. References to backbone plasmids used in this study are given in Supplementary Table S1 B. DNA fragments to be cloned were amplified using Phire Hot Start II DNA Polymerase (Thermo Fisher Scientific, Waltham, USA). Colony PCRs were conducted using RUN DNA Taq polymerase (A&A Biotechnology). Plasmid DNA isolation, agarose gel extraction, genomic DNA extraction, and post-reaction purification were all conducted using an appropriate kit from A&A Biotechnology. Restriction enzymes BsmBI and BsaI and T4 DNA ligase were purchased from NEB (New England Biolabs Ltd, Ipswich, USA) and used according to the manufacturer’s instructions. NotI and BglII endonucleases were purchased from Thermo Fisher Scientific. The preparation of competent cells and transformation of E. coli strains was conducted according to a standard heat shock protocol (Sambrook and Russell 2001 ). Y. lipolytica strains were transformed using the lithium acetate transformation protocol (Chen et al. 1997 (link)).
9
GUS staining and genetic analysis of hairy root clones
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GUS staining assays of hairy root clones and regenerated lines were conducted using previous methods (Butler and Hannapel, 2012 ) and visualized using a CanoScan LiDE 110 flatbed scanner (Cannon, Melville, NY). PCR amplicons were generated using primers 5′‐GTAGCTGCATGGAAAGATG‐3′ and 5′‐CTGAAGAAACCTGTTCAATG‐3′ with the Phire Hot Start II DNA polymerase (Thermo Fisher Scientific, Waltham, MA) and digested using the HindIII restriction enzyme (New England Biolabs, Ipswich, MA) under recommended conditions to detect mutations within the gPDSa target site (Figure 2a ). Resistant bands were purified from 2% agarose gels using QIAquick Gel Extraction Kit (Qiagen, Valencia, CA) and subcloned using the Topo TA Cloning Kit (Life Technologies, Grand Island, NY) for Sanger sequencing at the University of Wisconsin Biotechnology Center. At least six colonies were sequenced per band for genotyping, and if more than two alleles were identified, the mutation was considered chimeric.
10
Genomic DNA Isolation from Bulk Transfections
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To isolate genomic DNA from bulk transfections, cells were directly sorted into a 50 μL master mix consisting of 1X Phire Hot Start II DNA Polymerase (ThermoFisher), 1 μM forward primer, and 1 μM reverse primer. PCR was performed using the primers in Additional File 19 : Table S2 and the PCR conditions listed in Additional File 20 : Table S3. All products sizes were confirmed on a 1% agarose gel prior to Sanger sequencing. Amplicons were purified using the QIAquick PCR purification kit (Qiagen) according to manufacturer’s instructions prior to Sanger sequencing. PCR products were column purified and Sanger sequencing (Genewiz) was performed using the primers listed in Additional File 19 : Table S2. EditR was used to analyze Sanger sequence chromatographs to assess bating editing efficiencies with the parameters listed in Additional File 21 : Table S4 [54 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!