The largest database of trusted experimental protocols

Ag reverse transcription kit

Manufactured by Accurate Biology
Sourced in China

The AG Reverse Transcription Kit is a laboratory tool used for the conversion of RNA into cDNA. It provides the necessary components for the reverse transcription process, which is a fundamental step in various molecular biology and biotechnology applications.

Automatically generated - may contain errors

2 protocols using ag reverse transcription kit

1

RNA Extraction and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
In this study, we use TRIzol reagent (Invitrogen, Carlsbad, CA, United States) to extract total RNA from human nucleus pulposus cells and rat nucleus pulposus tissues.
Total RNA was extracted from human nucleus pulposus cells or rat nucleus pulposus tissues by using the TRIzol RNA isolation protocol (Invitrogen, Inc., Carlsbad, CA, United States). AG Reverse Transcription Kit (Accurate biotechnology, Changsha, Hunan, China) was used to reverse transcribe total RNA into cDNA and SYBR Premix ExTaq II (Yeasen Biotechnology, Shanghai, China) SYBR was used for the reactions of qPCR. Then we used a ABI 7500 sequencing detection system (Applied Biosystems, Foster City, CA, United States) to measure the reactions and applied the β-actin as a control RNA expression level. Data were analyzed by GraphPad Prism (GraphPad Prism Software 6.0, United States). The primers we used in the experiments: β-actin, AGA​GCT​ACG​AGC​TGC​CTG​AC, PLK1, CAC​CAG​CAC​GTC​GTA​GGA​TT, MMP3, CCT​ACA​AGG​AGG​CAG​GCA​AG, MMP13, TCG​GCC​ACT​CCT​TAG​GTC​TT, COL2A1, CCA​GAT​GAC​CTT​CCT​ACG​CC, ADAMTS4, AAC​GTC​AAG​GCT​CCT​CTT​GG, ADAMTS5, CCG​GAG​CCA​CTG​CTT​CTA​TC, aggrecan, GGG​ACC​TGC​AAG​GAG​ACA​GAG, SOX9, GCT​CTG​GAG​ACT​TCT​GAA​CGA, p53, CCA​GGA​TGT​TGC​AGA​GTT​GTT​A, p21, TAT​TTT​GTC​CTT​GGG​CTG​CCT, p16, CTT​CGG​CTG​ACT​GGC​TGG.
+ Open protocol
+ Expand
2

Comprehensive RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from tissue samples using Trizol reagent (Sparkjade, China), according to the manufacturer’s instructions. Then 1 µg RNA was reverse-transcribed using AG reverse transcription kit (Accurate Biology, China). The RT-qPCR reactions were performed using SYBR Green qPCR Mix kit (Sparkjade, China) according to the manufacturer’s instructions. The extraction and amplification of miRNAs was performed according to the manufacturer’s instructions (Vazyme, China). The primers for RT-qPCR are shown in Table 3.

Primer Sequences of circRNA, miRNAs, mRNAs for RT-qPCR

RNAsForward Primer (5’-3’)Reverse Primer (5’-3’)
hsa_circ_0031594GCTTGCTATCCGGGAAATGGGGGCTCCACATCTGCTATGA
hsa-miR-1260bATCCCACCACTGCCACCGAACATGTCTGCGTATCTC
hsa-miR-6507-5pAGGGAAGAATAGGAGGGACTCTTTGCATGGTACTGAACCA
U6CTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT
NCAPG2GGAACTGGCATTTGACACGAGCGCTGCTCTAACAATGGGTGGCT
PRC1ATAGCCAGGAGCAGAGACAAGCAACCGCACAATCTCAGCATCGTG
β-actinCACCATTGGCAATGAGCGGTTCAGGTCTTTGCGGATGTCCACGT
GAPDHTGACTTCAACAGCGACACCCACACCCTGTTGCTGTAGCCAAA
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!