The largest database of trusted experimental protocols

Rna extraction kit

Manufactured by GE Healthcare
Sourced in United Kingdom

The RNA extraction kit is a laboratory tool designed to isolate and purify ribonucleic acid (RNA) from biological samples. The kit contains the necessary reagents and materials to efficiently extract and concentrate RNA for further analysis and experimentation.

Automatically generated - may contain errors

4 protocols using rna extraction kit

1

Tick RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from homogenized tick samples was extracted using GE Healthcare RNA extraction kit (Chicago, USA). Complementary DNA (cDNA) was synthesized using a GoScript Reverse Transcriptase (Promega, Madison, Wisconsin, USA). Briefly, a mixture of 1 μl of RNA, 5 μl of poly T primers and 14 μl of nuclease-free water were preheated at 70°C for 10 min. The mixture was then placed on ice pending further steps. The enzyme mix (1 × first strand buffer, 4 μl of MgCl2, 2 mM dNTP, 0.51 μl of SUPERase inhibitor, 1 μl of superscript II, 5 μl of the RNA mix, and RNase-free water) was then incubated in a thermocycler according to the manufacturer's cycling conditions; one cycle of 10 min at 25°C, 45 min at 37°C, 45 min at 42°C, followed by 15 min at 70°C. The cDNA was used immediately or stored at −20°C until it was needed for further analysis.
+ Open protocol
+ Expand
2

Real-time PCR analysis of chondrocyte gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
HAC culture pellets were collected and RNA was extracted using an RNA extraction kit (GE Healthcare) following the manufacturer’s protocol. A total RNA (0.25 μg) was converted to cDNA using a BIOLINE SensiFAST™ cDNA synthesis kit following the mixer and reaction protocol. Real-time PCR was performed to investigate gene expression using a BIOLINE SensiFAST™ SYBR® No-ROX Kit. The primers were purchased from Invitrogen (Table 1). The level of gene expression of the samples was compared with that of GADPH (the house-keeping gene) calculated using the 2-ΔΔCT method [10 (link)].

Real-Time PCR Primers sequences

GeneReal-time PCR primer sequence (5′-3′)
ACANForward: ACTTCCGCTGGTCAGATGGAReverse: TCTCGTGCCAGATCATCACC
XT-1Forward: GTGGATCCCGTCAATGTCATCReverse: GTGTGTGAATTCGGCAGTGG
XT-2Forward: CGAATCGCCTACATCATGCTGGReverse: TAAACGGCCTTGAGGAGACG
CHSY-IForward: CCCGCCCCAGAAGAAGTCReverse: TCTCATAAACCATTCATACTTGTCCAA
ChPFForward: AGATCCAGGAGTTACAGTGGGAGATReverse: CCGGGCGGGATGGT
IL-1βForward: AAACAGATGAAGTGCTCCTTCCAGGReverse: TGGAGAACACCACTTGTTGCTCCA
MMP-13Forward: TTGAGCTGGACTCATTGTCGReverse: GAGCCTCTCAGTCATGGAG
ADAMTs-4Forward: CCCCAGACCCCGAAGAGCCAReverse: CCCGCTGCCAGGCACAGAAG
DECForward: CCTGATGACCGCGACTTCGAGReverse: TTTGGCACTTTGTCCAGACCC
GADPHForward: GAAGGTGAAGGTCGGAGTCReverse: GAAGATGGTGATGGGATTTC
+ Open protocol
+ Expand
3

Chondrogenic gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from cultured scaffolds on days 7, 14, and 21 were extracted using an RNA extraction kit (GE Healthcare, UK), in accordance with the manufacturer’s protocol. 200 ng of total RNA were converted to cDNA using RevertAid™ H minus first strand cDNA synthesis kit (Fermentus Life science, USA). In order to determine the chondrogenic gene expression, SYBR Green detection was used, and the values were normalized using glyceraldehyde-3-phosphate dehydrogenase (GAPDH). A real-time quantitative polymerase chain reaction (PCR) was performed in a DNA Engine (ABi 7500) using SYBR GREENER qPCR UNIVERSAL (Invitrogen, USA). Primers sequences are as follows: Aggrecan core protein (ACAN) forward: 5′CTGTTCAGGGACAGAATGTGCT3′, Aggrecan core protein (ACAN) reverse: 5′TCGATATGCTTCACAGTTCTAGGG3′, Collagen type I (COL1A2) forward: 5′TTTTGGCCATCTCTTCCTTCA3′, Collagen type I (COL1A2) reverse: 5′TGTGGATGCCTC TTGGGTATC3′, Collagen type II (COL2A1) forward: 5′TCCTCTTCTTGAGCTGGACTCATTCT3′, Collagen type II (COL2A1) reverse: 5′CGCTCTGCAAACTGGAGGTC3′, SOX9 forward: 5′ GAAGGTGAAGGTCGGAGTC3′, SOX9 reverse: 5′GAAGATGGTGATGGGATTTC3′, GAPDH forward: 5′GAAGGTGAAGGTCGGAGTC3′, GAPDH reverse: 5′ GAAGATGGTGATGGGATTTC3′. Relative expression levels of each gene were calculated by normalizing them with the expression of GAPDH by the 2-ΔCT method [56 (link)].
+ Open protocol
+ Expand
4

Tissue Culture and Cytokine Sourcing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissue culture mediums and others related reagents were purchased from Gibco (Grand Island, NY, USA). Recombinant human IL1β, OSM and leptin were purchased from Peprotech (NJ, USA). An RNA extraction kit was purchased from GE Healthcare (Buckinghamshire, UK). A Tetro cDNA™ synthesis kit and 2x Sensifast™ SYBR Lo-Rox mix was purchased from Bioline (London, UK). The human MMP3 and MMP13 ELISA kits were purchased from Elabscience (Texas, USA). Other reagents were purchased from Sigma-Aldrich and Invitrogen.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!