The pmirGLO vector (genepharma) for dual luciferase experiments is kept in our laboratory. PmirGLO-wild-CCR7 and pmirGLO-mut-CCR7 were constructed based on the binding site of CCR7 and miRNA-320. PmirGLO-wild-8244 and pmirGLO-mut-8244 were constructed based on the binding site of lncRNA 8244 and miRNA-320. These plasmids are utilized for verifying targeting relationships. The plasmid expressing the CCR7 gene (pmCherry-CCR7) was purchased from the miaoling plasmid platform (Miaolingbio, China). Sus scrofa_NONSUSG008244.1 (http://www.noncode.org , accessed on 1 February 2023) overexpression lentiviral vector was constructed by Jiman Biotechnology Co., Ltd. (Zhaoqing, China). Additionally, miRNA-320 mimics and inhibitor were purchased from Jiman Biotechnology Co., Ltd., while anti-β-actin (rabbit) monoclonal antibody (abcam), anti-TLR3 (pig) monoclonal antibody (abcam), mouse IFN-beta antibody (R&D). Anti-SVA-VP1 are kept in our laboratory.
Anti β actin rabbit monoclonal antibody
Manufactured by Abcam
Sourced in United Kingdom
Anti-β-actin rabbit monoclonal antibody is a laboratory reagent used to detect the presence and quantify the levels of β-actin, a highly conserved cytoskeletal protein, in biological samples. This antibody is produced in rabbits and is designed for use in various immunoassay techniques, such as Western blotting, immunohistochemistry, and flow cytometry.
Automatically generated - may contain errors
Lab products found in correlation
Pierce bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Ripa lysis buffer, by Thermo Fisher Scientific (2 mentions)
Pmirglo vector, by GenePharma (1 mentions)
Peroxidase conjugated anti rabbit igg, by Merck Group (1 mentions)
Pierce enhanced chemiluminescence kit, by Thermo Fisher Scientific (1 mentions)
Rabbit monoclonal anti gfp antibody, by Abcam (1 mentions)
Rabbit anti akt antibody, by Cell Signaling Technology (1 mentions)
Rabbit anti bax antibody, by Cell Signaling Technology (1 mentions)
Hrp conjugated anti rabbit or anti mouse igg antibody, by Jackson ImmunoResearch (1 mentions)
Bca protein assay kit, by Beyotime (1 mentions)
Protease and phosphatase inhibitor, by Roche (1 mentions)
Enhanced chemiluminescence kit, by Merck Group (1 mentions)
Alkaline phosphatase conjugated secondary antibody, by Merck Group (1 mentions)
Pvdf membrane, by Merck Group (1 mentions)
8 protocols using anti β actin rabbit monoclonal antibody
1
Dual Luciferase Assay for miRNA-320 Targeting
2
Western Blot Analysis of Protein Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein was purified by acetone precipitation from the cell lysates as previously described [29 (link)]. Briefly, the protein pellet was dissolved in 1% SDS buffer, and centrifuged for 5min at 14000 rpm. Proteins were separated on 10% SDS-PAGE gels and transferred to a PVDF membrane followed by Western blot. 8% non-fat milk in TBS containing 0.1% Tween-20 was used to block non-specific binding. The blot was then incubated with an anti-TNF-α rabbit monoclonal antibody (1:200, Abcam, Cambridge, MA, USA), or an anti-β-actin rabbit monoclonal antibody (1:200, Abcam) at 4°C overnight followed by a secondary antibody (peroxidase-conjugated anti-rabbit IgG 1:5000, Millipore Corporation). An Azure C300 chemiluminescence system (Dublin, CA, USA) was used for detection.
3
Quantitative Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein samples were quantified using a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA), according to the manufacturer’s protocols. Protein samples were heated with SDS sample buffer (0.25 M Tris–HCl, pH 6.8, 0.5 M DTT, 10% SDS, 50% glycerol and 0.5% bromophenol blue) at 95 °C for 5 min, a total of 30 μg were loaded per lane and then separated on 15% SDS-PAGE and electroblotted onto polyvinylidene fluoride membranes (GE10600023, GE Healthcare Life Sciences, Logan, UT, USA). Subsequently, the membranes were incubated with one of the primary rabbit polyclonal antibodies at a dilution of 1:1,000 (Abcam) or anti-β-actin rabbit monoclonal antibody at a dilution of 1:5,000 (Abcam) overnight at 4 ℃. Immunoreactive bands were detected by incubation with horseradish peroxidase-conjugated goat anti-rabbit (Abcam) at a dilution of 1:5,000 for 2 h at room temperature. Detection by chemiluminescence was performed using a Pierce enhanced chemiluminescence kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA).
4
Knockdown of PirB in HEK293 and Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The short interfering RNA (siRNA) expression vector pLenR-GIP-GFP was used, and the PirB (Lilrb3, NM_031713.1) siRNA sequence was 5′GCTGGAAAGTTATGTGAATGC3′. Western blot analysis confirmed the knockdown of endogenous PirB in the transfected HEK293 cells and primary cortical neurons. Briefly, HEK293 cells were transiently transfected with a control RNAi construct or PirB expression construct, which also expressed GFP. The expression of PirB, GFP and β-actin in cell was determined by Western blot analysis using the corresponding specific antibodies (anti-PirB rabbit monoclonal antibody, 1:1000, Abcam; anti-GFP rabbit monoclonal antibody, 1:1000, Abcam; and anti-β-actin rabbit monoclonal antibody, 1:2000, Abcam, respectively) at 24 h after transfection. The secondary antibodies were used as previously described.
5
Quantification of Apoptosis-Related Proteins by Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein levels of AKT, phosphorylated AKT, BCL2, BAK and BAX were determined by Western immunoblotting analysis as previously described [34 (link)]. In brief, proteins isolated from cells (50 μg) were loaded and separated by electrophoresis on a 10% SDS polyacrylamide gel and then transferred to a nitrocellulose membrane. The membrane was probed with either rabbit anti-Akt antibody (Cell Signaling Technology), rabbit anti-phosphorylated AKT antibody (Cell Signaling Technology), rabbit anti-BAK antibody (Cell Signaling Technology), rabbit anti-BAX antibody (Cell Signaling Technology), or mouse anti-BCL2 antibody (Neomarkers). All antibodies were diluted at 1:1000. HRP-conjugated anti-rabbit or anti-mouse IgG antibody (Jackson ImmunoResearch) was used as the secondary antibody. The corresponding protein bands were visualized using enhanced chemiluminescence reagents. The same membranes were re-probed with rabbit anti-β-actin monoclonal antibody (Abcam) to confirm equal loading of proteins for each sample.
6
Western Blot Analysis of HIF-1α and TET2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
KG-1 cells were collected and lysed using RIPA lysis buffer (Thermo Fisher Scientific, Inc.) containing protease and phosphatase inhibitors (Roche Applied Science). The supernatants were collected via centrifugation at 12,000 × g for 15 min at 4°C. Total protein was quantified using the bicinchoninic acid (BCA) protein assay kit (Beyotime Institute of Biotechnology). Proteins were resolved using 10% SDS PAGE, transferred onto PVDF membranes (mass of protein loaded was 20 µg/lane) and blocked with 5% skimmed milk for 1.5 h at room temperature. The membranes were incubated with primary antibodies (all 1:1,000), mouse-anti-HIF-1α monoclonal antibody (cat. no. H1alpha67; Abcam), rabbit-anti-TET2 polyclonal antibody (cat. no. ab94580; Abcam) or rabbit-anti-β-actin monoclonal antibody (cat. no. 4967; Cell Signaling Technology, Inc.) respectively, overnight at 4°C. Following the primary incubation, membranes were incubated with secondary antibodies (1:20,000; cat. no. 926-32211; LI-COR Biosciences) for 1 h at room temperature. The membranes were visualized using an enhanced chemiluminescence kit (EMD Millipore). Semi-quantitative analysis was performed using ImageJv.1.8.0 software (National Institutes of Health).
7
Reg1 Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein of 20 μg in each lane was separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels (e-PAGEL 15%, ATTO CORPORATION, Tokyo, Japan) according to the manufacturer's protocol. After completion of electrophoresis, proteins were transferred onto PVDF membranes and detected with a mouse antibody against lithostathine-1 (Reg1) (1: 2000; R&D System, Minneapolis, MN, USA). Alkaline phosphatase conjugated secondary antibodies (Merck KGaA, Darmstadt, Germany) were diluted 1: 30,000. To calibrate the expression levels of Reg1, β- actin was used as an internal control with a rabbit anti-β-actin monoclonal antibody (Abcam, Cambridge, UK). Antigens on the membrane were detected with ProtoBlot® II AP Systems with Stabilized Substrate (Promega, Fitchburg, WI, USA). Gel images were converted to densitograms using Image J software 1.45I (http://rsb.info.nih.gov/ij/ ).
8
Immunoblotting Assay for TLR4 and NF-κB Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sixty (60) µg of cell extract were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene di uoride (PVDF) membrane (Millipore, Bedford, MA, USA). The membrane was blocked for 1 h with 5% non fat milk in TBST and then incubated with a rabbit monoyclonal antibody against TLR4 (AbcamCompany, UK) at 4 °C over night. After washing with TBST, the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antirabbit antibodies (1:5000; Boster Co., Wuhan, China) for 60 min at room temperature. After additional washing, bound conjugates were detected by ECL superSignalTM West Pico substrate (Pierce, Rockford, IL, USA). Proteins were visualized by exposing the blot to X-ray lm, photographed with a digital camera, and then the net intensities of the individual bands were measured using Bandscan 5.0 software. Rabbit anti-β-Actin monoclonal antibody (AbcamCompany, UK) was used as the loading control, and TLR4
protein expression was normalized to Actin.
The WB process of MyD88, TRAF6, I κ K β, I κ B, P-I κ B and NF -κ B are the same as that of TLR4.
protein expression was normalized to Actin.
The WB process of MyD88, TRAF6, I κ K β, I κ B, P-I κ B and NF -κ B are the same as that of TLR4.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!