The procedure involved 3 main steps: HCV RNA extraction, conversion of HCV RNA to complementary DNA (cDNA), and amplification and detection of the amplified products. HCV RNA extraction was performed by using an Artus® HCV RG RT-PCR kit (Qiagen GmbH, Germany, Cat No. 4518263) according to the manufacturer’s instructions. HCV levels were determined using the Rotor-Gene Q MDx (Rotor-Gene Q MDx, Qiagen, Germany) Light Cycler Real-Time PCR System using Rotor-Gene-3000 software version 6.0.23 under the following conditions: 50°C, 25 min; 94°C, 2 min; 5 cycles of 94°C for 10 s, 55°C for 15 s, and 72°C for 15 s; and 42 cycles of 94°C for 10 s, 60°C for 45 s, and 40°C for 30 s. Fluorescence was measured at 60°C for each cycle. An internal quality control serum was included during RT-PCR.
Rotor gene q mdx
Manufactured by Qiagen
Sourced in Germany
The Rotor-Gene Q MDx is a real-time PCR thermal cycler designed for diagnostic applications. It features a compact, modular design and supports up to 72 samples. The Rotor-Gene Q MDx is capable of performing quantitative and qualitative real-time PCR analysis.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Rnx plus, by CinnaGen (1 mentions)
Rneasy mini kit 50, by Qiagen (1 mentions)
Nanodrop system, by Thermo Fisher Scientific (1 mentions)
Mircury lna sybr green pcr kit, by Qiagen (1 mentions)
Maxima sybr green fluorescin qpcr master mix, by Thermo Fisher Scientific (1 mentions)
Transstart green qpcr supermix, by Transgene (1 mentions)
Transscript 2 one step gdna removal and cdna synthesis supermix, by Transgene (1 mentions)
Rotor gene sybr green pcr kit, by Qiagen (1 mentions)
Genelute total rna purification kit, by Merck Group (1 mentions)
Artus hcv rg rt pcr kit, by Qiagen (1 mentions)
9 protocols using rotor gene q mdx
1
HCV RNA Quantification Workflow
2
High-Resolution Melt Analysis (HRMA) Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HRMA protocol, primers, and conditions used here were based on those described by Loveless [34 (link)] and are shown in Table 14 . The analyses were performed using Type-it HRMA PCR kit (cat#206542, Qiagen, Germantown, MD, USA). The total volume of HRMA reactions was 25 µL and the reaction mixes were prepared according to the manufacturer instructions. Final concentrations of the primers (Eurofins/Operon, Louisville, KY, USA) in the reaction mix were 0.7 µM; template DNA was added to achieve the final concentration of approximately 100 pg/µL. The HRMA PCRs were performed on Rotor-Gene Q MDx (Qiagen, Hilden, Germany) using the following cycling conditions: 5 min at 95 °C, followed by 45 cycles of (10 s at 95 °C, 30 s at 55 °C), ending with melt curve generation (65 °C to 95 °C at 0.1 °C increments, 2 s each). Samples with Ct > 35 cycles or without sigmoidal amplification curves were called negative or invalid, respectively. Melt curves of valid amplifications were analyzed and clustering performed using ScreenClust software with unsupervised cluster analysis [55 (link)].
3
RT-qPCR Analysis of COVID-19 Related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by RNX-Plus (CinnaGen, Iran). After assessment of RNA quantity and quality respectively evaluated by NanoDrop 2000 (Thermo Fisher Scientific, USA) and gel electrophoresis, cDNAs were synthesized by first strand cDNA synthesis kit (Thermo Scientific, USA) according to manufacturers’ instructions. RT-qPCR was performed by Rotor-Gene Q MDX (QIAGEN Hilden, Germany). The expression level of ACE, AGTR1, ACE2 and TMPRSS2 transcripts were determined using SYBR Premix Ex Taq II (Takara, China) and specific primers which were presented in Table 1 . All experiments were performed in duplicate. The relative mRNA levels in studied genes expression were normalized to Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression, as internal control [21 ].Table 1
The sequence of forward and reverse primers.
| Primers | Sequence 5′→3 | Reference |
|---|---|---|
| GAPDH Forward | GAGGGCCATCCACAGTCTTCTG | [21 ] |
| GAPDH Reverse | CCCTTCATTGACCTCAACTACATGGT | |
| ACE Forward | GGAGGAATATGACCGGACATCC | [27 (link)] |
| ACE Reverse | TGGTTGGCTATTTGCATGTTCTT | |
| ACE2 Forward | AACCCAGATAATCCACAAGAATGC | The current study |
| ACE2 Reverse | TCATAGTCTCCTCTCCAATAATCCC | |
| AGTR1 Forward | ATTTAGCACTGGCTGACTTATGC | [28 (link)] |
| AGTR1 Reverse | CAGCGGTATTCCATAGCTGTG | |
| TMPRSS2 Forward | TCATCCTTCAGGTGTACTCATCTC | The current study |
| TMPRSS2 Reverse | TCCGCTGTCATCCACTATTCC |
4
Quantifying Gene Expression in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from mouse tissue samples by using the RNeasy Mini Kit (50) (Qiagen, Germany), according to the manufacturer's suggested protocol. RNA integrity, quantity, and quality were determined by agarose gel electrophoresis and the Nano Drop system (Nano Drop Technologies, Inc., Wilmington, DE, USA). RNA was stored at −70°C before use. One-μg samples of RNA were used for complementary DNA (cDNA), which was synthesized by using the total Reverse Transcription Kit (Takara, Japan) after the adjustment of the concentrations, according to the manufacturer’s instructions. β-actin gene was used as the reference gene. The sequence of primers for target genes were listed in Table 1 . qPCR was carried out on a real-time PCR cycler (Rotor-Gene Q MDx, Qiagen).
5
miRNA Quantification using RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MiRCURY LNA™ SYBR Green PCR kit (#339346, QIAGEN, United States), commercially designed primers, cDNA, and nuclease-free water were used for amplification of the product. The desired master mix was prepared from the abovementioned reagents in a tube, and the obtained mixture was mixed well by vortexing and spun down. The mixture was dispensed in tubes, and cDNA was diluted (1:60) in nuclease-free water and added to these tubes separately. The tubes were placed in a thermocycler (Rotor-Gene Q MDx, QIAGEN, working on Q-Rex software, Germany) by following reaction conditions as 95°C for 2-min, followed by 40 cycles of denaturation at 95°C for 10-min, annealing at 56°C for 1-min, and melting curve at 60–95°C. U6 was used as an internal reference gene. The ΔΔCt model was used for the relative quantification of RT-PCR data of miRNA.
6
Quantitative Real-Time PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specific primer pairs were used to amplify total cDNA (30 ng) template (Table 1 ), using Maxima SYBR Green/Fluorescin qPCR Master Mix (2X, Thermo Scientific, Waltham, MA, USA). The thermal profile was: initial denaturation at 95°C for 5 minutes, then 35 cycles at 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, and final extension step for 5 minutes at 72°C. Samples were subjected to quantitative real-time PCR in duplicates, and then the mean values were used for subsequent analysis. Rotor-Gene Q MDx (Qiagen, USA) performed the amplification, automatically collected the data, and afterwards analyzed the value of threshold Cycle (Ct), which was normalized to an average Ct value of the housekeeping gene (∆Ct). The relative gene expression fold change was estimated using 2−∆∆ct method,28 (link) standardized to the reference housekeeping gene 16S rRNA.
List of Primer Sequences Used for Quantitative Real-Time PCR (qRT-PCR)
| Gene | Primer Direction | 5′- 3′ Sequence | Reference |
|---|---|---|---|
| Forward | CCTAGTAAAGCTCCGGAA | [40 (link)] | |
| Reverse | CTAGTCCATTCGGTCCA | ||
| Forward | TCTCTTGCAGGAGCAATCAA | [41 (link)] | |
| Reverse | TCAGGCACTAACATCCAGCA | ||
| Forward | ATGGTCAAGCCCAGACAGAG | ||
| Reverse | CGTGTTTTCAACATTTAATGCAA | ||
| Forward | CGTGCCTAATACATGCAAGTC | [42 (link)] | |
| Reverse | CCGTCTTTCACTTTTGAACCA |
7
RT-qPCR Analysis of Gene Expression
8
Transcriptional Analysis of Bacterial Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cultures were grown overnight in BHI at 37°C and then diluted 100-fold in fresh BHI. Subcultures were collected at the logarithmic phase (OD690 value of 0.8), and total RNA was isolated with the GenElute total RNA purification kit (Sigma) according to the manufacturer’s instructions. Total cDNA was obtained by the QuantiTect Reserve Transcription kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The copy number of a specific cDNA was calculated using the Rotor-Gene Q MDx instrument and the Rotor-Gene SYBR Green PCR kit (Qiagen). The 16S rDNA housekeeping gene was analyzed as an internal control. The primers used for qRT-PCR assays are reported in Table 1 .
9
Plasma-based EGFR Mutation Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Scorpion-ARMS EGFR Plasma RGQ PCR Kit is an in vitro diagnostic test for the detection of the 21 EGFR mutations (Del 19, L858R and T790M) on cftDNA extracted from plasma using a real-time polymerase chain reaction (Q-PCR) on the Rotor-Gene Q MDx instrument (Qiagen S.p.A. Milan, Italy). The kit utilizes two technologies, amplification refractory mutation system (ARMS) that ensures distinguishing between a match and a mismatch at the 3’ end of a PCR primer, combined with Scorpions, bifunctional molecules containing a PCR primer covalently linked to a probe to cause increased fluorescence from the reaction tube. The assays were carried out according to manufacturer’s instructions. Each run contains a positive and a negative control and each sample is analyzed for the mutations and for a control assay that amplifies a region of exon 2 of the EGFR gene and is used as a reference to calculate the ∆Ct. The assay provides a qualitative assessment of the mutation status.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!