Applied biosystems quantstudio 5

Total RNA was extracted using a RNeasy Mini kit (Qiagen) following the manufacturer’s instructions. RNA concentration and purity were evaluated by spectrophotometry (NanoDrop 2000c, Thermo Fischer Scientific). A maximum of 500 ng of RNA were reverse transcribed with both oligo dT and random primers using a PrimeScript RT Reagent Kit (Perfect Real Time, Takara Bio Inc.) in a 10 µL reaction. Real-time PCR reactions were performed in duplicate using Takyon ROX SYBR MasterMix blue dTTP (Eurogentec) on an Applied Biosystems QuantStudio 5 (Thermo Fischer Scientific). Transcripts were quantified using the following program: 3 min at 95°C followed by 40 cycles of 15 s at 95°C, 20 s at 60°C and 20 s at 72°C. Values for each transcript were normalized to expression levels of RPL13A (60S ribosomal protein L13a), using the 2-ΔΔCt method. Primers used for quantification of transcripts are indicated within Supplementary Table 2.

Viral supernatants containing 75 ng of p24 were mixed with 2× ERT buffer (100 mM Tris–HCl, pH 8.0, 0.5 mM dNTPs, 6 mM MgCl₂, 6 mM EDTA and 0.016% NP-40) and incubated at 37°C for 5 or 10 h. Reactions were terminated by the addition of an equal volume of stop buffer (2% SDS, 20 mM EDTA, 200 μg/ml proteinase K) followed by a 3 h incubation at 56°C. Following ERT, viral DNA was phenol–chloroform extracted, ethanol precipitated and resuspended in 34 μl of H₂O. ERT products were digested with DpnI to eliminate residual transfection plasmid. Quantitative PCR (qPCR) was performed in triplicate using Takyon ROX SYBR MasterMix blue dTTP (Eurogentec) on an Applied Biosystems QuantStudio 5 (ThermoFisher Scientific), using the following program: 3 min at 95°C followed by 40 cycles of 15 s at 95°C, 20 s at 60°C and 20 s at 72°C. Rreverse transcriptase products were quantified using M667 and M661 primers, which detect the presence of complete minus-strand DNA (38 (link)), and results were normalized to expression levels of glyceraldehyde phosphate dehydrogenase (GAPDH) transcripts. Primer sequences were as follows: M667, GGCTAACTAGGGAACCCACTG; M661, CCTGCGTCGAGAGAGCTCCTCTGG; GAPDH Forward, ACTTCAACAGCGACACCCACT; GAPDH Reverse, GTGGTCCAGGGGTCTTACTCC.

Total RNA was extracted using the RNeasy Mini kit and submitted to DNase treatment (Qiagen), following the manufacturer's instructions. RNA concentration and purity were evaluated by spectrophotometry (NanoDrop 2000c, ThermoFisher Scientific), and 500 ng of RNA were reverse transcribed with both oligo(dT) and random primers, using the PrimeScript RT Reagent Kit (Perfect Real Time, Takara Bio Inc.) in a 10 μl reaction. Real-time PCRs were performed in duplicate using Takyon ROX SYBR MasterMix blue dTTP (Eurogentec) on an Applied Biosystems QuantStudio 5 (Thermo Fisher Scientific). Transcripts were quantified using the following program: 3 min at 95°C followed by 35 cycles of 15 s at 95°C, 20 s at 60°C and 20 s at 72°C. Values for each transcript were normalized to expression levels of RPL13A (60S ribosomal protein L13a), using the 2^−ΔΔCt method. Primer sequences were as follows: RPL13A forward, AACAGCTCATGAGGCTACGG; RPL13A reverse, TGGGTCTTGAGGACCTCTGT; FTSJ3 forward, CATCCGGGGTCACCAGTTAT; FTSJ3 reverse, TCACCGTCGTCCTCAACATC.

Human MCSF-MDM and GMCSF-MDM were harvested after 6 days of differentiation culture and whole-cell RNA was isolated and purified using RNeasy Mini Kit (cat. # 74106, Qiagen; Hilden, Germany), performing DNA digestion with RNase-free DNase I Set (cat#. 79256, Qiagen) before eluting. RNA concentration and purity were determined by UV absorbance spectrophotometry with a NanoDrop 2000c (Thermo Fisher). cDNA was prepared by reverse transcription PCR using 1 μg of RNA as template and using MultiScribe Reverse Transcriptase with the random primers scheme for initiation of cDNA synthesis (part of the High Capacity cDNA RT Kit; cat.# 43-688-13, Thermo Fisher). PowerUP SYBR Green Master Mix (cat.# A25776, Thermo Fisher) with Dual-Lock Taq DNA polymerase and ROX as passive reference dye was used for quantitative RT-PCR in an Applied Biosystems QuantStudio 5 (Thermo Fisher). All manufacturer's recommended steps were followed. Validated, commercially available PCR primers (see primer information in Table S3 of Supplemental Methods) were purchased from Qiagen (RT² qPCR Primers, cat#. 330001) and used for quantitative PCR assays. The 2 ^−ΔΔCT method was used to calculate relative expression following normalization to the housekeeping gene Hprt.