Peasy e2 expression kit

Biotinylated miRNAs were purchased from Takara. The coding region of TDP-43 was amplified with the following primers: TDP-FATGTCTGAATATATTCGGGT, TDP-R CTACATTCCCCAGCCAGAAG. The full-length TDP-43 tagged with His at the C-terminus (His-TDP-43 wild type) was constructed using the pEASY-E2 expression kit (Transgen).The wild-type His-TDP-43 was expressed in Escherichia coli stain Transetta (DE3) (Transgen) by incubation for 18 h at 16°C with 1 mmol/L IPTG. The resulting protein was then purified with Ni-NTA Fast Start Kit (Qiagen) in accordance with the manufacturer’s instructions. The biotin-labeled miRNAs were incubated with His-TDP-43 and the assays were carried out using LightShift Chemiluminescent RNA EMSA Kit (Thermo) following the manufacturer’s instruction.

p-NP esters with various carbon chain lengths (p-NPC₂ to p-NPC₁₆) were purchased from Sigma-Aldrich (USA) or TCI (Tokyo, Japan). Diisobutyl phthalate (DiBP), dibutyl phthalate (DBP), Bis (2-ethylhexyl) phthalate (DEHP), and diethyl phthalate (DEP) were purchased from J&K Scientific Ltd., China. pEASY-E2 expression kit and fast pfu DNA polymerase were provided by TransGen Biotech (Beijing, China). Escherichia coli BL21(DE3) and pET-28a(+) expression vector was from Novagen (USA). Qiagen provided the Nickel-NTA agarose (Germany). pEGFP-N3, pMD18-T and restriction enzymes BamHI and HindIII were purchased from Takara. Luria–Bertani (LB) bacteria growth medium was obtained from Thermo Fisher Scientific (USA). All other chemicals were at least analytical grade and were obtained from Sigma (USA) or Sinopharm Chemical Reagent (Shanghai, China).