Itaq universal sybr green supermix reagent

Manufactured by Bio-Rad

Sourced in United States

The ITaq™ Universal SYBR Green Supermix is a ready-to-use qPCR reaction mix containing all the necessary components, including SYBR Green I dye, for real-time quantitative PCR analysis. It is designed for reliable and sensitive detection of DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

SYBR Green Supermix (1501 citations) SYBR Green (1276 citations) ITaq Universal SYBR Green (125 citations) SYBR Green reagent (109 citations) ITaq SYBR Green (82 citations) ITaq Supermix (28 citations) Universal SYBR Supermix (5 citations) Universal SYBR Green (5 citations) ITaq reagent (3 citations) SYBR reagents (2 citations)

14 protocols using itaq universal sybr green supermix reagent

Quantitative analysis of gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

First-strand cDNA was synthesized from 2 μg of total RNA using Superscript First-Strand Synthesis System (Invitrogen, New York, United States).
Quantitative PCR was carried out using 3 biological and 3 technical replicates in a Mastercycler RealPlex (Eppendorf, Hamburg, Germany) using the iTaq Universal SYBR Green Supermix reagents (Bio-Rad). The program consisted of an initial denaturation and Taq polymerase activation step of 10 minutes at 95°C, 40 cycles of 15 s at 95°C, 1 minute annealing and elongation at 60°C, followed by a melting curve from 59°C to 95°C.
Quantitative analysis of target gene transcription was carried out using the 2exp(-ΔΔCT) method (Livak and Schmittgen, 2001 (link)).

Schneider S., Turetschek R., Wedeking R., Wimmer M.A, & Wienkoop S. (2019). A Protein-Linger Strategy Keeps the Plant On-Hold After Rehydration of Drought-Stressed Beta vulgaris. Frontiers in Plant Science, 10, 381.

+ Open protocol

+ Expand

Quantitative Analysis of Intestinal Cell Types

Check if the same lab product or an alternative is used in the 5 most similar protocols

Intestinal tissues (<5 mg) were homogenized in Buffer RLT Plus containing β-mercaptoethanol using the FastPrep system. 50,000 KRT20-tdT⁺ and 50,000 KRT20-tdT⁻ cells from Krt20^CreER/R26R^tdTomato mice were sorted into Buffer RLT Plus containing β-mercaptoethanol. Total RNA was isolated using the RNeasy Plus Micro Kit (QIAGEN). cDNA was synthesized with iScript Reverse Transcription Supermix reagents (Bio-Rad). qRT-PCR was performed with iTaq Universal SYBR Green Supermix reagents (Bio-Rad) on a StepOne Real-Time PCR System (Applied Biosystems). Expression levels were normalized to B2m. Relative expression was calculated using the ΔΔCt method. Primers used in this study are listed in Table S3.

Ohara T.E., Colonna M, & Stappenbeck T.S. (2022). Adaptive differentiation promotes intestinal villus recovery. Developmental cell, 57(2), 166-179.e6.

+ Open protocol

+ Expand

Quantifying Gene Expression in C. elegans

Check if the same lab product or an alternative is used in the 5 most similar protocols

C. elegans animals were washed off plates with M9 buffer and collected in 15 ml conical tubes. After centrifugation, the worm pellets were washed three times with M9 buffer to remove bacteria. Trizol (Takara Bio) was added to the worm pellets, which after vortexing were placed in liquid nitrogen and thawed at 37°C for 6 times. After that, total RNA was extracted following the instructions of the manufacturer (Takara Bio). Two micrograms of total RNA were used for cDNA synthesis using the Oligo-d(T)₁₅ primer. Real-time PCR analysis was performed on the rpl-26, ced-1 and psr-1 genes using the CFX96 Real-Time PCR Detection System (Bio-Rad) and iTaq Universal SYBR Green Supermix reagents (Bio-Rad). PCR reactions were run in triplicate and three independent experiments were performed. The mean mRNA level of the housekeeping gene rpl-26 was used as a control to normalize the variability in expression levels. Primer sequences used in real-time PCR reactions were: rpl-26 forward primer 5’ ATGAAGGTCAAT-CCGTTCGT 3’ and reverse primer 5’ AGGACACGTCCAGTGTTTCC 3’; ced-1 forward primer 5’ CTGCAATTGGCTGCTGCCATGTAGA 3’ and reverse primer 5’AGACCATTGGGTGGTCCTCCTTGAT 3’; and psr-1 forward primer 5’ CATGC-GAAGGACAAAGCGAG 3’ and reverse primer 5’ CGAAATCTCGGCGGAACTCC 3’.

Yang H., Chen Y.Z., Zhang Y., Wang X., Zhao X., Godfroy JI I.I.I., Liang Q., Zhang M., Zhang T., Yuan Q., Royal M.A., Driscoll M., Xia N.S., Yin H, & Xue D. (2015). A lysine-rich motif in the phosphatidylserine receptor PSR-1 mediates recognition and removal of apoptotic cells. Nature communications, 6, 5717.

+ Open protocol

+ Expand

Gene Expression Analysis by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the Omega E.Z RNA kit with an on-column treatment with 50 units of RNAse-free DNase I for 30 min. Single-stranded cDNA was generated with the High Capacity cDNA Reverse Transcription reagents (Applied Biosystems), and qPCR was performed on an Applied Biosystems 7900H with the relative standard curve method and iTaq Universal SYBR Green Supermix reagents (Biorad). qPCR primers are shown in Supplemental Table S2 (qPCR tab).

Catizone A.N., Uzunbas G.K., Celadova P., Kuang S., Bose D, & Sammons M.A. (2020). Locally acting transcription factors regulate p53-dependent cis-regulatory element activity. Nucleic Acids Research, 48(8), 4195-4213.

+ Open protocol

+ Expand

Quantification of Legume Globin Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 40–70mg of roots (6–10 roots) with the RNAqueous isolation kit (Ambion) and cDNA was synthesized using DNase-treated RNA with (dT)₁₇ and Moloney murine leukemia virus reverse transcriptase (Promega). qPCR analysis was performed using a 7500 Real-Time PCR system (Applied Biosystems) and iTaq Universal SYBR Green Supermix reagents (Bio-Rad). Primers for LjGlb1-1 (5′-TCT CAC TTC ACT TCC ATC GCA-3′ and 5′-TCA GTG AAA CAT GTG CTC CCA-3′) and LjGlb1-2 (5′-GGC AGA AAA CAC AAC CAC CAT-3′ and 5′-TCA CCA CCA GAG CTT CTT GCT-3′) were used with a PCR program consisting of an intial denaturation and Taq polymerase activation step of 10min at 95 ºC, followed by 40 cycles of 15s at 95 ºC and 1min at 60 ºC, and a final melting curve stage. Primer specificity and the absence of contaminating genomic DNA were verified, respectively, by amplicon dissociation curves and by PCR analysis of RNA samples prior to reverse transcription. Expression levels were normalized using ubiquitin as reference gene, which was found to remain constant in roots during the few days of measurements.

Fukudome M., Calvo-Begueria L., Kado T., Osuki K.I., Rubio M.C., Murakami E.I., Nagata M., Kucho K.I., Sandal N., Stougaard J., Becana M, & Uchiumi T. (2016). Hemoglobin LjGlb1-1 is involved in nodulation and regulates the level of nitric oxide in the Lotus japonicus–Mesorhizobium loti symbiosis. Journal of Experimental Botany, 67(17), 5275-5283.

+ Open protocol

+ Expand

Robust RNA Isolation and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using TRIzol reagent (Ambion by Life Technologies) and the RNA Clean and Concentrator kit (Zymo Research). The RNA was DNase-treated using the TURBO DNA-free^™ kit (Invitrogen) and reverse transcribed using the High-Capacity cDNA Reverse Transcription reagents (Applied Biosystems). The resulting cDNA was used for qPCR analysis with iTaq Universal SYBR Green Supermix reagents (Biorad) and CFX384 Touch Real-Time PCR system (Biorad). The RT-qPCR primer sequences are shown in Table 1.

Badu P, & Pager C.T. (2023). Activation of ATF3 via the Integrated Stress Response Pathway Regulates Innate Immune and Autophagy Processes to Restrict Zika Virus. bioRxiv.

+ Open protocol

+ Expand

Gene Expression in Lung Samples after LPS Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression of genes of interest was performed in lung samples harvested on day three after LPS treatment. The lung tissue was stored immediately after retrieval in the Trizol. The tissue was homogenized in Trizol using Powergen 125 (FS-PG125, Fisher Scientific) homogenizer, and RNA was extracted using the Zymogen total RNA microprep kit (Zymogen) according to the product instructions. A Nanodrop instrument was used for quantitative and qualitative analysis of the extracted RNA. cDNA synthesis was performed using 200ng of total RNA, iScript gDNA clear cDNA synthesis Kit (Cat# 1725034, Bio-Rad) was used for this. The total cDNA obtained was diluted five times before amplification with iTaq- Universal SYBR Green Supermix reagent (Cat# 172512, Bio-Rad) on Bio-Rad quantitative PCR platform (96-well format). Quantification was performed using the delta-delta C_T method, using HPRT as a housekeeping gene. Details of the primer sequence are given in Table 1.

Arora S, & Vyavahare N. (2023). Elastin-targeted nanoparticles delivering doxycycline mitigate cytokine storm and reduce immune cell infiltration in LPS-mediated lung inflammation. PLOS ONE, 18(6), e0286211.

+ Open protocol

+ Expand

Quantification of Cytokine mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

After 8 h of cell stimulation, splenocytes were washed and preserved in RNAlater at -80°C. Then, after cells were homogenized using a syringe, the total cytoplasmic RNA was isolated using the RNAeasy Mini Kit (Qiagen, Germany), and the first-strand cDNA was synthesized using the iScript RT Supermix (BioRad, USA), according to the manufacturer’s instructions. In order to quantify the mRNA expression levels for Il1b, Il17, Il23, and Tnfa, for the qRT-PCR analysis, the appropriate primers (Supplementary Table S1) and the iTaq Universal SYBR Green Supermix reagent (BioRad, USA) were used. Amplification reactions were conducted as follows: a first denaturation step of 95°C for 30 s, followed by 40 cycles of 95°C for 10 s, 60°C for 10 s, and 72˚C for 20 s. Fold change of mRNA expression was calculated relative to the Hprt expression levels, using the 2^-ΔΔCt method followed by a log₂-transformation.

Monasterio G., Castillo F., Astorga J., Hoare A., Terraza-Aguirre C., Cafferata E.A., Villablanca E.J, & Vernal R. (2020). O-Polysaccharide Plays a Major Role on the Virulence and Immunostimulatory Potential of Aggregatibacter actinomycetemcomitans During Periodontal Infection. Frontiers in Immunology, 11, 591240.

+ Open protocol

+ Expand

Genotyping G59S-hDCTN1 Mutant Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mice were genotyped using DNA isolated from a 0.5 cm piece of mouse tail. Isolation was performed with the GenEluteTM mammalian genomic DNA miniprep kit (Sigma, St. Louis MO). The presence of the G59S-hDCTN1 mutant gene was determined by QPCR using iTaq universal SYBR Green supermix reagent (Bio-Rad, Hercules, CA). Briefly, 2.275 ng (6.5 μl of 0.35 ng/μl solution) of genomic DNA was added to a reaction mixture containing 12.5 μl of the universal supermix, 3 μl each (final concentration 0.3 μM) of the forward (5’ATGGGTGGGCGTGATTCTG-3’) and reverse (5’-ACTGGCGTACAAAGATGCCG-3’) primers for a total volume of 25 μl. After initial activation of the Taq polymerase at 95°C for 5 min, 40 PCR cycles of 95°C for 30 sec, 58°C for 30 sec and 72°C for 45 sec were performed. Assays were performed, in duplicate, on a Chromo 4 Quantitative PCR System (Bio-Rad, Hercules, CA). The B6.SJL Chromosome 17 interval specific mice were characterized by PCR using two markers (D17Mit51 and D17Mit176) located within the interval, that differ between SJL and B6.

Heiman-Patterson T.D., Blankenhorn E.P., Sher R.B., Jiang J., Welsh P., Dixon M.C., Jeffrey J.I., Wong P., Cox G.A, & Alexander G.M. (2015). Genetic Background Effects on Disease Onset and Lifespan of the Mutant Dynactin p150Glued Mouse Model of Motor Neuron Disease. PLoS ONE, 10(3), e0117848.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using RNAzol (Molecular Research Center) and cDNA reverse-transcription was performed using iScript™ cDNA Synthesis Kit (Bio-Rad). RT-qPCR was performed on StepOnePlus Real-time PCR system (Applied Biosystems) using the iTaq™ Universal SYBR Green Supermix reagent (Bio-Rad). ΔΔCT method was used to calculate the relative expression of target genes, which was normalized to housekeeping gene β−2-microglobulin (B2m). Primer information is listed in Supplementary Table 1.

Gilliam A.C, & Steitz J.A. (1993). Rare scleroderma autoantibodies to the U11 small nuclear ribonucleoprotein and to the trimethylguanosine cap of U small nuclear RNAs.. Proceedings of the National Academy of Sciences of the United States of America, 90(14), 6781-6785.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!