Pfu ultra 2 polymerase

Total RNAs isolated from L-Chrebp^−/− livers were used to synthesize first-strand cDNAs using the PrimeScript First Strand cDNA synthesis kit from Clontech (6110A), which were used as templates for PCR amplifications. Two PCR reactions were carried out with PfuUltra II polymerase (Agilent Technologies) using 5′ primers corresponding to the 5′ end of either ChREBP-α (5′-GTGGCCATGGCGCGCGCGCTGGCGGATC-3′) or ChREBP-β (5′-GACGCCATCTGCAGATCGCGTGGAGC-3′). Both reactions used the same 3′ primer, 5′-AGGATTATAATGGTCTCCCCAG­GGTGCC-3′, corresponding to the common 3′ end of ChREBP-α and ChREBP-β. The abundance of the PCR product amplified by ChREBP-α primers was >10-fold higher than that of ChREBP-β primers. Both products were cloned into pCR2.1-TOPO vector and sequenced. The results confirmed that the PCR product of ChREBP-α primers in the L-Chrebp^−/− livers encoded an aberrant ChREBP-α with an internal deletion of amino acid residues 301-826. Likewise, the PCR product of ChREBP-β primers encoded an aberrant ChREBP-β with the internal deletion of the same region. Because the aberrant ChREBP-β is expressed at an extremely low level in L-Chrebp^−/− liver (<3% of that of full-length ChREBP-β in control liver, see supplemental Tables S2A and S2B), only the aberrant ChREBP-α (designated as ChREBPΔ) was evaluated for activity.

Nucleotide sequences of primers are listed in Table S3. All restriction enzymes were purchased from New England Biolabs. For construction of the cCF10-inducible tig complementation vector, tig was amplified from purified OG1RF genomic DNA using Pfu Ultra II polymerase (Agilent), digested with BamHI-HF/NheI-HF, and ligated to pCIEtm (23 (link)) treated with the same restriction enzymes. The plasmid construct was verified by Sanger sequencing (Eurofins). For generation of constitutive fluorescent protein constructs, P₂₃ was excised from pDL278p23 (57 (link)) by digestion with EcoRI-HF/BamHI-HF and ligated to pTCV-LacSpec digested with the same restriction enzymes. A fragment encoding promoterless GFP (58 (link)) flanked by BamHI and BlpI sites was inserted to create pP₂₃::GFP, and the BamHI-SphI fragment from pJ201::187931 was inserted to create pP₂₃::tdTomato. The Tn insertions in strains used for submerged Aclar disc and MultiRep reactor experiments were verified by colony PCR using the oligonucleotides listed in Table S4. The Tn insertion adds ∼2.1 kb to the size of the wild-type allele.

Ftz and Ftz-F1 coding regions were cloned into the pAc5.1 ⁄ V5-His C expression vector (Thermo Fisher Scientific) without any tags. To that end, RNA was purified from 0–12 hours old Drosophila embryos using the Trizol reagent (Thermo Fisher Scientific) and reverse transcribed into cDNA using MMLV-Reverse Transcriptase (Promega). The primers that were used for cloning Ftz (forward: 5’ AAGGTACCATGGCCACCACAAACAGC 3’, reverse: 5' AAGGATCCTCATCAAGACAGATGGTAGAGGTCC 3') include a KpnI restriction site in the forward primer and a BamHI restriction site in the reverse primer. The coding region of Ftz-F1 was amplified using the Berkeley Drosophila Genome Project (BDGP) LD15303 clone as a template. The primers that were used for cloning Ftz-F1 (Forward: 5’ CCGAATTCATGGATACCTTCAATGTACCTATGCTGGCGGAGAG 3’, Reverse: 5’ TTGGATCCTACTATCCCTTGCGCTTGGCGTGCAG 3’) include an EcoRI restriction site in the forward primer and a BamHI restriction site in the reverse primer. All PCR reactions were carried out using PfuUltra II polymerase (Agilent Technologies). PCR fragments were initially cloned into the pGEM-T Easy vector (Promega) before cloning into the final expression plasmids. The DNA sequence of each plasmid was verified by sequencing reactions (Hy Labs).

In separate PCR steps (see Supplementary Fig. S1A), the assembly fragments (5′ untranslated region-AGT and 3′ untranslated region) were amplified with primers 5′-UTR fwd (5′-CCGCCGGTACCTCCCAAGCCTG-3′), 5′-UTR rev (5′-TGGCGAAAGGGGGATGTGC-3′), 3′ UTR fwd (5′-AGTGAGGATCCGGCTGCTAACAAAGCC-3′) and 3′ UTR rev (5′-TGCTAGCGCTATATGCGTTGATGC-3′), respectively, from the plasmid pIVEX-AGT-DHFR using Pfu Ultra II polymerase (Agilent Technologies). Identical thermo-cycling conditions were used as above apart from the annealing temperatures (60°C). After DpnI digestion and purification of the amplicons, the library was assembled by overlap extension PCR using the PCR fragments from the separate amplification steps described above using the primers LMB 2-6 (5′-ATGTGCTGCAAGGCGATTAAG-3′) and pIV-BG (5′-BG-­GCGTTGATGCAATTTCTATGC-3′). The final construct was subjected to PEG-MgCl₂ precipitation, as described in Stein and Hollfelder (2009) (link) to remove any remaining primer-dimers. Samples were run on an agarose gel to confirm DNA fragments with the correct size were amplified (see Supplementary Fig. S1B).