Cd98hc

For lentivirus production [14 (link)], 4 µg of the following plasmids: pMDLg/RRE, pRSV-Rev and pMD2.G (Addgene, Cambridge, MA, USA), along with 8 µg of the pLKO.1 lentiviral plasmid containing a scramble shRNA (sh-Control) or the shRNAs for CD98hc (GE Dharmacon, Lafayette, CO, USA) were co-transfected by JetPEI® reagent (Polyplus-transfection, Illkirch, France) into HEK293T cells as described [37 (link)]. Twenty-four hours later, HEK293T medium was replaced with fresh medium and 48 h after the co-transfection, the medium containing lentiviral particles was collected, filtered, and used to infect HT29 and HCT116 cells after the addition of 6 µg/ml polybrene (Sigma-Aldrich). Cells were cultured for 48 h and were subsequently selected with 3 µg/ml puromycin (Sigma-Aldrich) for another 48 h. Five different shRNA sequences targeting CD98hc were tested (#3 GCCTGGACTCTTCTCCTATAT; #4 CGAGAAGAATGGTCTGGTGAA; #5 TCCGTGTCATTCTGGACCTTA; #6 GCTGGGTCCAATTCACAAGAA; #7 CTAGCTCATACCTGTCTGATT) and those that produced higher levels of knockdown (#3 and #7) were used.

For lentivirus production [14 (link)], 4 µg of the following plasmids: pMDLg/RRE, pRSV-Rev and pMD2.G (Addgene, Cambridge, MA, USA), along with 8 µg of the pLKO.1 lentiviral plasmid containing a scramble shRNA (sh-Control) or the shRNAs for CD98hc (GE Dharmacon, Lafayette, CO, USA) were co-transfected by JetPEI® reagent (Polyplus-transfection, Illkirch, France) into HEK293T cells as described [37 (link)]. Twenty-four hours later, HEK293T medium was replaced with fresh medium and 48 h after the co-transfection, the medium containing lentiviral particles was collected, filtered, and used to infect HT29 and HCT116 cells after the addition of 6 µg/ml polybrene (Sigma-Aldrich). Cells were cultured for 48 h and were subsequently selected with 3 µg/ml puromycin (Sigma-Aldrich) for another 48 h. Five different shRNA sequences targeting CD98hc were tested (#3 GCCTGGACTCTTCTCCTATAT; #4 CGAGAAGAATGGTCTGGTGAA; #5 TCCGTGTCATTCTGGACCTTA; #6 GCTGGGTCCAATTCACAAGAA; #7 CTAGCTCATACCTGTCTGATT) and those that produced higher levels of knockdown (#3 and #7) were used.