Trizol extraction reagent

Manufactured by Vazyme

TRIzol extraction reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA from various biological samples, including cells and tissues. The reagent facilitates the separation of RNA from DNA and proteins during the extraction process.

Automatically generated - may contain errors

Lab products found in correlation

Sybr green, by Vazyme (2 mentions) Abi viia 7 system, by Thermo Fisher Scientific (1 mentions) Abi viia7 qpcr system, by Thermo Fisher Scientific (1 mentions)

2 protocols using trizol extraction reagent

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol extraction reagent (Vazyme, R401) was used to isolate total RNA which was then reverse-transcribed using a Reverse Transcriptase master mixing kit (Vazyme, R201) according to the manufacturer's procedure. Primers (18s rRNA forward primer: CAGCCACCCGAGATTGAGCA, 18s rRNA reverse primer: TAGTAGCGACGGGCGGTGTG; Rad54l2 forward primer: AGGAGTGTGACAGGGATGATG; Rad54l2 reverse primer: TCCTCGGAGGCTAGGTTCTTG; ER-α forward primer: AGATCTTCGACATGCTGCTGGCTA, ER-α reverse primer: AGACTTCAGGGTGCTGGACAGAAA; ER-β forward primer: TGGGCACCTTTCTCCTTTAGTGGT, ER-β reverse primer: TCTTGCTTCACACCAGGGACTCTT) were synthesiszed by Tsingke Biological Technology. PCR amplifications were operated by using SYBR Green (Vazyme, Q711) and ABI ViiA7 System (Applied Biosystems). Relative expression of target gene was calculated by the comparative2 ^–(ΔΔCt) method normalizing on 18S rRNA.

Lu Y., Zhu Y., Ma W., Liu N., Dong X., Shi Q., Yu F., Guo H., Li D, & Gan W. (2023). Estrogen associates with female predominance in Xp11.2 translocation renal cell carcinoma. Scientific Reports, 13, 6141.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using TRIzol extraction reagent (Vazyme, R401) and was then reverse‐transcribed using a Hiscript II Reverse Transcriptase master mixing kit (Vazyme, R201) according to the manufacturer's instructions. All primers (Supplementary Table S4) were synthesised by Tsingke Biological Technology. PCR amplicons were quantified by SYBR Green (Vazyme, Q711) using an ABI ViiA 7 Q‐PCR System (Applied Biosystems). The relative abundance was analysed using the 2 –(ΔΔCt) method and normalised against 18S rRNA.

Liu N., Chen Y., Yang L., Shi Q., Lu Y., Ma W., Han X., Guo H., Li, D, & Gan, W. (2022). Both SUMOylation and ubiquitination of TFE3 fusion protein regulated by androgen receptor are the potential target in the therapy of Xp11.2 translocation renal cell carcinoma. Clinical and Translational Medicine, 12(4), e797.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!