M mlv reverse transcriptase kit

Total RNA was extracted using the RNAiso plus reagent (Takara Bio). Then, cDNA was prepared from 2 μg total RNA using the M-MLV reverse transcriptase kit (Promega) according to the manufacturer’s protocol. Subsequently, q-PCR was performed with specific primers and iTaq SYBR GREEN Supermix in a BioRad iCycler (Bio-Rad). The primers were shown in Table S1. The relative mRNA levels of each target gene were calculated by normalizing them to the β-actin mRNA levels based on the 2^−ΔΔCT method. In all RT-qPCR experiments, each unknown sample was estimated in duplicate.

Total RNA was isolated from leaves collected from 6-week-old T₀ transgenic N. benthamiana plants with a NucleoSpin RNA plant Kit (Macherey–Nagel) and thereafter used as template for cDNA synthesis with an oligo-dT primer and a M-MLV reverse transcriptase kit (Promega). qRT-PCR was performed as previously described (Wang et al. 2014 (link)). Transcript levels of AtLecRK-I.9 and AtLecRK-IX.1 were normalized to NbActin.

Human microdissected tissues at defined stages were homogenized and whole RNA was extracted using the Trizol method according to manufacturer's recommendations (Thermofisher). cDNA was synthesized using the M‐MLV reverse transcriptase kit (Promega) and assessed for the absence of genomic DNA contamination. PCR was carried out using standard conditions using cDNA with the following gene specific primers: MC1R‐Fwd‐ACTTCTCACCAGCAGTCGTG, MC1R‐Rev‐CATTGGAGCAGACGGAGTGT. TUBB3‐Fwd‐ TCTACGACATCTGCTTCCGC and TUBB3‐Rev‐ TCGTCTTCGTACATCTCGCC.

Total RNA was extracted with TRI reagent (Molecular research center, Cincinnati, OH, USA) from whole WT and Prmt1 KO testes. Then, 2 μg of total RNA was reverse-transcribed into cDNA using the Moloney Murine Leukemia Virus (M-MLV) Reverse Transcriptase Kit (Promega Corporation, Fitchburg, WI, USA) and RT-PCR was performed. Further, qPCR was performed using the StepOnePlus Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA) and TOPreal^TM qPCR SYBR PreMix (Enzynomics, Daejeon, Republic of Korea) according to the manufacturer’s instructions. Relative gene expression was examined using the 2^−ΔΔCTmethod with GAPDH as an internal control. At least three independent experiments were performed.

To determine the relative expression of genes involved in osmoprotection that are present in Exiguobacterium SH31: opuBA, putP, glnA, proC, gltA, gbsA, fliG, fliS, ywqC, bdlA, luxS, and pgaC, transcripts levels were quantified by qt RT-PCR. Exiguobacterium SH31 was grown in YP medium at 25°C with constant agitation in the three different conditions (0, 25, and 50 g/l of NaCl) until reaching an OD₆₀₀ of 0.4. At this point, the cultures were pelleted and RNA extractions were carried out using the GeneJET RNA Purification Kit (Thermo Scientific) according to manufacturer’s instructions. RNA integrity, quality, and quantity were verified using 1% agarose electrophoresis and OD_260/280 ratios. cDNA was synthesized using the M-MLV Reverse Transcriptase kit (Promega) and Random Primer oligonucleotides hexamers (Invitrogen^TM). The PCR reaction was carried out as follows: 10 minutes at 95°C followed by 40 amplification cycles (95°C × 30 s, 58°C × 30 s, 72°C × 30 s), and a final step of 95°C × 15 s; 25°C × 1 s; 70°C × 15 s; and 95°C × 1 s) using primers specific for each gene (Supplementary Table S4). Transcript levels were quantified using the Brilliant II SYBR Green qPCR Master mix kit (Agilent Technologies) on a Stratagene Mx3000P thermal cycler. Gene expression levels were calculated according to Pfaffl (2001) (link) using 16S rRNA gene as normalizator.