Lightcycler 480 sybr green 1

Total RNA was extracted from leaves of PPV-challenged transgenic lines collected in the third cycle of PPV testing. They were treated with Turbo DNaseI (Thermo Fisher Scientific) before complementary DNA synthesis with the Superscript II® reverse transcriptase from Invitrogen/ Revertaid/Ribolock reverse transcriptase kit (Fermentas), using an oligo-dT (16) primer. Relative qPCR to quantify PpeIF4E, PpeIF4G, PpeIFiso4G10 and PpeIFiso4G11 mRNA accumulation was performed on a Light Cycler 480 II machine (Roche Diagnostics) by using LightCycler® 480 SYBR Green I master and one tenth of the newly synthesized cDNAs. Expression of TEFII (Prupe.4G138700) was used as internal reference. Based on re-sequenced Japanese plum copies, specific primers were designed for each copy of the Prunus translation initiation factor genes as well as for the internal reference gene (Additional file 10: Table S4). RT-qPCR procedures for cycling conditions and relative expression statistical analysis are detailed elsewhere [53 (link)]. Values statistically different when comparing the expression level of wild-type and transgenic lines were verified by analysis of summary rank with the Kruskal-Wallis test with the R v 3.2.5 software.

2 μl of cDNA was quantified in duplicate for each sample using LightCycler 480 SYBR Green I (Roche) on a LightCycler 480 II as per manufacturer instructions. Cycling conditions were: 15 min at 95 °C, 45 cycles of [15 s at 94 °C, 25 s at 58 °C, 20 s at 72 °C]. Melt curve cycles immediately followed and were: 5 s at 95 °C, 1 min at 65 °C and then gradual temperature rise to 97 °C at a rate of 0.11 °C/s followed by 30s at 40 °C. GDF3 levels were normalized to MAPK3 [86 (link)] as a reference gene because MAPK3 has been shown not to change with differentiation in contrast to many other standard housekeeping genes such as actin, which change dramatically during the differentiation process [87 ]. Melt curve analysis was performed to verify primer specificity and all primers were tested in a dilution series before use. Data is displayed as fold change above proliferative condition mRNA levels using 2^(ΔΔCt) values.
Primer sequences were obtained from the MIT/Harvard PrimerBank.
GDF3 fwd: 5’ ATGCAGCCTTATCAACGGCTT
GDF3 rev: 5’ AGGCGCTTTCTCTAATCCCAG
GDF3 PrimerBankID: 6679979a1
MAPK3 fwd: 5’ TCCGCCATGAGAATGTTATAGGC
MAPK3 rev: 5’ GGTGGTGTTGATAAGCAGATTGG
MAPK3 PrimerBankID: 21489933a1

Total RNA was extracted from samples according to the manufacturer’s instructions of the RNAiso plus kit (TaKaRa, Dalian, China). They were reverse transcribed with poly (T) adapters into cDNA using a PrimeScript^TM RT reagent Kit with gDNA Eraser kit (TaKaRa, Dalian, China). The cDNA products of each tissue were normalized using Actin (AB181991) as the internal reference gene [7 (link)]. These products were used as templates for qRT-PCR. qRT-PCR was performed on a LightCycler® 480 (Roche, Switzerland) using LightCycler 480 SYBR Green I (Roche, Switzerland). The qRT-PCR programmes were performed according to the following protocol: 95 °C for 2 min, 40 cycles of 95 °C for 5 s and 56 °C for 20 s, according to a thermal denaturing step to generate the melt curves. All reactions were run in triplicates, including the non-template controls. Statistical analysis was performed using the 2-ΔΔct method [40 (link)]. The primers were shown in the Additional file 1: Table S1.

qRT-PCR was performed to determine the validity of miRNA by deep sequencing for expression profile analysis. Total RNA was extracted as described above. According to previous reports [20 (link), 39 (link)], the miRNA abundance was detected. Briefly, we first polyadenylated the total RNA (3 μg) including miRNAs, and then used the Mir-X^TM miRNA First-Strand synthesis kit (Clontech, Inc., Terra Bella, USA) to reverse transcribe poly (T) adapters into cDNA. Using the internal reference gene UBQ, we normalized the cDNA products [20 (link)]. These products were used as templates for qRT-PCR. qRT-PCR was performed on a LightCycler® 480 (Roche, Switzerland) using LightCycler 480 SYBR Green I (Roche, Switzerland). Along the entire miRNA sequence and adapter sequence provided by miRNA First-Strand synthesis kit (Clontech, Inc., Terra Bella, USA), the miRNA-specific forward primer for each miRNA and the universal reverse primer were designed. The primers were shown in the Additional file 1: Table S1. qPCR was performed according to the following protocol: 95 °C for 2 min, 40 cycles of 95 °C for 5 s and 60 °C for 20 s, followed by a thermal denaturing step to generate the melt curves. All of the reactions were performed in triplicate, including non-template controls. Statistical analysis was performed using the 2^-ΔΔct method [40 (link)].

Ribonucleic acid samples were processed and quantified as in (Logrip and Zorrilla, 2012 (link)). Briefly, RNA was extracted with QIAzol (Qiagen, Inc., Valencia, CA, USA), samples were treated with DNase I (EMD Millipore, San Diego, CA, USA) to remove genomic DNA contamination, and concentrations were determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA, USA). cDNA was reverse transcribed using the Superscript III First Strand Synthesis System (Invitrogen, Carlsbad, CA, USA) with Oligo (dT)₂₀ primers. Gene expression levels were assessed by quantitative polymerase chain reaction (qPCR) using Light Cycler 480 SYBR Green I (Roche Applied Science, Indianapolis, IN, USA) and 0.5 μM primers per reaction (ValueGene Inc., San Diego, CA, USA), with sequences and primer conditions as previously described (Sabino et al., 2009 (link); Logrip and Zorrilla, 2012 (link)). Reactions were run on a Mastercycler ep realplex⁴ thermal cycler (Eppendorf North America, Hauppauge, NY, USA). Threshold cDNA copy number was interpolated per standard curves of purified PCR product, and results were analyzed via second derivative methods. Cyclophilin A (Cyp) was used as the internal standard.

NOS3 (sc-654) and DUSP4 (sc-1200) antibodies were obtained from Santa Cruz (Santa Cruz, CA, USA); p-ERK1/2 (9101S), ERK1/2 (9102S), p-p38 (4511S), p38 (9212S), GAPDH (2118S), p-JNK (4671S), JNK (3708S), cleaved caspase-3 (9664), and MK2 sampler kit antibodies (9329) from Cell Signaling (Cambridge, MA, USA); GSH (101-A-250) from ViroGen (Watertown, MA, USA). Secondary anti-rabbit (NA934V) and anti-mouse (NXA931) IgG-HRP antibodies were purchased from GE Life Sciences (Piscataway, NJ, USA). RNA was isolated using TRI Reagent^® purchased from Ambion (Carlsbad, CA, USA). cDNA was synthesized with a High-Capacity cDNA Reverse Transcription kit from Applied Biosystems (Foster City, CA, USA) and real-time PCR conducted using LightCycler 480 SYBR Green I from Roche (Mannheim, Germany).

Total RNA from somatosensory cortex was extracted using TRIzol (Invitrogen). Eluted RNA was reverse transcribed, and qPCR was performed using LightCycler 480 SYBR Green I (Roche Applied Science). Primer sequences:
BC1 forward: 5′-CTGGGTTCGGTCCTCAG-3′
BC1 reverse: 5′-TGTGTGTGCCAGTTACCT-3′
PSD95 forward: 5′-CATTGCCCTGAAGAACGC-3′
PSD95 reverse: 5′-ATGGATCTTGGCCTCGAA-3′
CamK2a forward: 5′-GTGCTGGCTGGTCAGGAGTATGC-3′
CamK2a reverse: 5′-CTTCAACAAGCGGCAGATGCGGG-3′
Hprt1 forward: 5′-CAGCCCCAAAATGGTTAAGGTTGC-3′
Hprt1 reverse: 5′-TCCAACAAAGTCTGGCCTGTATCCA-3′
Gusb forward: 5′-CCGCCGCATATTACTTTAAGAC-3′
Gusb reverse: 5′-CCCCAGGTCTGCATCATATTT-3′