Chip assay kit

Manufactured by Cell Signaling Technology

Sourced in United States

The ChIP assay kit is a tool used in molecular biology to study protein-DNA interactions. It allows for the identification and analysis of DNA sequences that are bound by specific proteins of interest within a cell. The kit provides the necessary reagents and protocols to perform chromatin immunoprecipitation (ChIP) experiments.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

ChIP kit (57 citations) ChIP assay (14 citations) Chromatin Immunoprecipitation (ChIP) Assay Kit (3 citations)

90 protocols using chip assay kit

ChIP-qPCR Analysis of GLUT3 Regulation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tumor cells (2 × 10⁶) were prepared for the chromatin immunoprecipitation (ChIP) assay with the ChIP assay kit (Cell Signaling Technology). The CREB-bound DNA of the GLUT3 gene was immunoprecipitated with CREB antibodies. The DNA was then used for polymerase chain reaction (PCR) using primers designed for the amplification of the GLUT3 promoter. The PCR product was analyzed and quantified as described before [24 (link)]. The primers used were as follows:

(1) forward: 5′-TATTTTCTT CTCCTGCTTAGCT-3′ and

reverse: 5′-AGTCATT TATAGT GTTTCCCTTC-3′ and

(2) forward: 5′-CCCAGGGTGGA GAGAGTGGAAG-3′ and

reverse 5′-TTATAATCTCCGCAA AGGGTGGAG-3′ and

(3) forward: 5′-GTCATATCCC AGCGAGACCC AG-3′ and

reverse: 5′-C GCTGTAATCTAA TTCAAGTCTTCAAG-3′.

Kuo M.H., Chang W.W., Yeh B.W., Chu Y.S., Lee Y.C, & Lee H.T. (2019). Glucose Transporter 3 Is Essential for the Survival of Breast Cancer Cells in the Brain. Cells, 8(12), 1568.

+ Open protocol

+ Expand

ChIP Assay for FOXG1, β-catenin, and TCF4

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the ChIP assay, 5 × 10⁶ cells were prepared with the ChIP assay kit (Cell Signaling Technology, Danvers, MA, USA) according to the manufacturer’s instructions. DNA complexes were immunoprecipitated using the anti-FOXG1 (USBio, ABIN2668064) or anti-β-catenin (USBio, ABIN442212) or anti-TCF4 (USBio, ABIN2372673) antibodies and then eluted by incubation for 30 min at 37 °C in 100 μl of 10 mM DTT. After centrifugation, the supernatant was diluted 50× with ChIP buffer. The resulting precipitated DNA samples were further analyzed by qPCR. The primers are listed in section “RNA extraction, reverse transcription, and qPCR” in Additional file 2.

Zheng X., Lin J., Wu H., Mo Z., Lian Y., Wang P., Hu Z., Gao Z., Peng L, & Xie C. (2019). Forkhead box (FOX) G1 promotes hepatocellular carcinoma epithelial-Mesenchymal transition by activating Wnt signal through forming T-cell factor-4/Beta-catenin/FOXG1 complex. Journal of Experimental & Clinical Cancer Research : CR, 38, 475.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation of Ulk1 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

The chromatin immunoprecipitation analysis was carried out using a ChIP assay kit (Cell Signaling Technology) in accordance with the manufacturer's protocol. The cells were directly cross‐linked in the culture medium in 1% formaldehyde for 10 min at room temperature and then digested with 0.5 μl micrococcal nuclease. The obtained chromatin was disrupted into fragments of 150–900 bp by using an ultrasonic bioruptor (BILON 96‐IIL). Primary antibodies against HMGN2, H3K27ac and IgG were added to the corresponding ChIP samples. The PCR was performed using primers designed from the sequences of the mouse Ulk1 promoter. The primer sequences were as follows: forward, 5′‐AGTCTCCGTCCCCACATACAG‐3′ and reverse 5′‐CTGGTCTCGAACTTGCTTTGTC‐3′. The data were normalized to the percentage of the input.

Du Y., Guo H., Guo L., Miao J., Ren H., Liu K., Ren L., He J., Wang X., Chen J., Li J., Wang Y., Wang J, & Huang N. (2021). The regulatory effect of acetylation of HMGN2 and H3K27 on pyocyanin‐induced autophagy in macrophages by affecting Ulk1 transcription. Journal of Cellular and Molecular Medicine, 25(15), 7524-7537.

+ Open protocol

+ Expand

ChIP-PCR Protocol for β-Catenin

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP was performed with a ChIP assay kit (Cell signaling, Beverly, MA, USA) according to the manufacturer's instructions using anti‐β‐catenin rabbit polyclonal antibody (#9562; Cell Signaling) and normal rabbit IgG (MBL, Aichi, Japan). The purified DNA was analyzed by PCR using primers. The primer pairs for R1 (forward, TCA GTA TGT CTT GCT GGC GA; reverse, TTT TAT TAC CCG ACA CAG GTG), R2 (forward, TGT GAC TAT GGG TGA TGG AG; reverse, TTG CCA TTT GTT TAC TTT CTC C), or R3 (forward, GCT GCA AGG ACA TTT CAC AC; reverse, GAG AGG CTC CAA TGA GAT CA).

Kokabu S, & Rosen V. (2017). BMP3 expression by osteoblast lineage cells is regulated by canonical Wnt signaling. FEBS Open Bio, 8(2), 168-176.

+ Open protocol

+ Expand

Regulation of miR-192 by p53 in HepG2

Check if the same lab product or an alternative is used in the 5 most similar protocols

HepG2 or BEL-7402 cells were transfected with p53 siRNA or control siRNA using Lipofectamine 3000 reagent (Invitrogen, USA). Twenty-four hours after transfection, the cells were harvested, and a ChIP assay was performed using a chromatin immunoprecipitation (ChIP) assay kit (Cell Signaling Technology, USA). Precipitated DNA was subjected to real-time PCR with miR-192 promoter primers (Table S2).

Sun L., Zhou X., Li Y., Chen W., Wu S., Zhang B., Yao J, & Xu A. (2020). KLF5 regulates epithelial-mesenchymal transition of liver cancer cells in the context of p53 loss through miR-192 targeting of ZEB2. Cell Adhesion & Migration, 14(1), 182-194.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP experiments were performed with ChIP assay kit (Cell signaling Technology, USA) according to the manufacturer’s guidelines. Briefly, 5 × 10⁶ RCC cells were cross-linked with 1% formaldehyde. Subsequently, the nuclear precipitate was fragmented through enzymatic digestion and sonication. After centrifugation, the supernatant was collected and incubated with identified antibodies overnight at 4 °C. Then, the chromatin antibody complex was de-crosslinked and the enriched DNA was purified and quantified by qRT–PCR.

Luo W., Xu Z., Wang H., Lu Z., Ding L., Wang R., Xie H., Zheng Q., Lin Y., Zhou Z., Li Y., Chen X., Li G, & Xia L. (2023). HIF1A-repressed PUS10 regulates NUDC/Cofilin1 dependent renal cell carcinoma migration by promoting the maturation of miR-194-5p. Cell & Bioscience, 13, 153.

+ Open protocol

+ Expand

ChIP and Re-ChIP Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For ChIP assay, 2 × 10⁶ cells were prepared using the ChIP assay kit (Cell Signaling Technology) according to the manufacturer’s instructions. In re-ChIP assay, 1 × 10⁷ cells were used for the first-step ChIP. The DNA complexes were first immunoprecipitated using the indicated antibodies and then eluted by incubation for 30 minutes at 37°C in 100 μl of 10mM DTT. The supernatant was diluted 50× with re-ChIP buffer and incubated using the indicated antibodies, as with the ChIP procedure. The resulting precipitated DNA samples were quantified by real-time PCR using the primers listed in Supplementary Table 2.

Chen Y., Fang R., Yue C., Chang G., Li P., Guo Q., Wang J., Zhou A., Zhang S., Fuller G.N., Shi X, & Huang S. (2019). Wnt-Induced Stabilization of KDM4C Is Required for Wnt/β-Catenin Target Gene Expression and Glioblastoma Tumorigenesis. Cancer research, 80(5), 1049-1063.

+ Open protocol

+ Expand

ChIP Assay for Promoter Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The ChIP assay was conducted using a commercial ChIP assay kit (Cell Signaling Technology) according to the manufacturer’s instructions. Briefly, following the indicated treatment, 5 × 10⁶ cells were fixed with 1% formaldehyde for 10 min at room temperature, washed twice with precooled PBS, collected and resuspended in ice-cold lysis buffer, and lysed on ice for 10 min. The cells were digested with micrococcal nuclease for 20 min at 37°C, and the reaction was stopped by adding EDTA and incubating on ice for 2 min. The chromatin (25 μg) was immunoprecipitated for 6 hours with 2 μg of specific antibodies against p23 (Biotech) or immunoglobulin G (rabbit, Santa Cruz Biotechnology) and protein G magnetic beads (25 μl) at 4°C on a rotating rack. The protein G agarose beads were then washed sequentially for 5 min with low-salt and high-salt buffer. The immune complexes were eluted with ChIP elution buffer for 30 min at 65°C under vortexing (1200 rpm). The eluted chromatin supernatant was digested with Proteinase K for 2 hours at 65°C to remove poteins, and the DNA was purified using spin columns. The human PTGS2 promoter-specific primers used for PCR were 5′-GACGTGACTTCCTCGACCCTC-3′ (forward) and 5′-AAGACTGAAAACCAA-GCCCAT-3′ (reverse). p23 exon–specific primers were 5′-ACAATGCTGACTATG-GCT-3′ (forward) and 5′-AGGGACTTGAGGAGGGTAG-3′ (reverse).

Yu Z., Peng Y., Gao J., Zhou M., Shi L., Zhao F., Wang C., Tian X., Feng L., Huo X., Zhang B., Liu M., Fang D, & Ma X. (2023). The p23 co-chaperone is a succinate-activated COX-2 transcription factor in lung adenocarcinoma tumorigenesis. Science Advances, 9(26), eade0387.

+ Open protocol

+ Expand

ChIP Assay for PD-L1 Promoter Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP assay was performed using a ChIP Assay Kit (Cell Signaling Technology, US) as described by Huang et al30 (link). Briefly, chromatin was crosslinked with 1% formaldehyde. Cells were lysed and sonicated with a Sonics Vibra-Cell processor (Sonics & Materials Inc., US). Chromatin was immuno-precipitated using the corresponding target protein antibody. Immuno-precipitated products were collected using Protein G agarose beads. DNA was purified with RNase A and Proteinase K. The PCR products were then electrophoresed on 2% agarose gels stained with GelRed. The following primers for the PD-L1 promoter were used for RT-PCR as recommended by Marzec et al.22 (link): 5′- CAAGGTGCGTTCAGATGTTG -3′ and 5′- GGCGTTGGACTTTCCTGA- 3′. The ChIP protocol is described in detail in supplementary information.

Tong L., Li J., Li Q., Wang X., Medikonda R., Zhao T., Li T., Ma H., Yi L., Liu P., Xie Y., Choi J., Yu S., Lin Y., Dong J., Huang Q., Jin X., Lim M, & Yang X. (2020). ACT001 reduces the expression of PD-L1 by inhibiting the phosphorylation of STAT3 in glioblastoma. Theranostics, 10(13), 5943-5956.

+ Open protocol

+ Expand

ChIP Assay for SKA2 Gene Quantification

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

For ChIP assay, approximately 1 × 10⁷ cells were harvested in medium and fixed with 1% formaldehyde. Glycine solution was added at a final concentration of 0.125 M to quench unreacted formaldehyde. Fixed cells were collected by spinning at 1500 rpm for 5 min. ChIP assays were performed using a ChIP Assay Kit (Cell Signaling Technology, Inc, USA) according to the manufacturer's instructions. IgG antibody was from the ChIP Assay Kit. CREB antibody was obtained from (Cell Signaling Technology, Inc, USA). Quantification of immunoprecipitated DNA was performed using qRT-PCR with LightCycler 480 SYBR Green I Master (Roche, US). The primers shown in Table 3 were designed according to the promoter region of SKA2 gene. Values derived from three independent experiments were normalized by background signals (IgG) and presented as percentage of Input chromatin (% Input) [37 (link), 38 (link)].

Zhuang H., Meng X., Li Y., Wang X., Huang S., Liu K., Hehir M., Fang R., Jiang L., Zhou J.X., Wang P, & Ren Y. (2016). Cyclic AMP responsive element-binding protein promotes renal cell carcinoma proliferation probably via the expression of spindle and kinetochore-associated protein 2. Oncotarget, 7(13), 16325-16337.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!