Biotin 11 dutp

Southern hybridization was performed in accordance with conventional protocols (Sambrook and Russell 2001 ) using the following equipment: BrightStar™-Plus Positively Charged Nylon Membrane (Thermo Fisher Scientific, Waltham, MA, USA), VacuGene XL Vacuum Blotting System (GE Healthcare, Chicago, IL, USA), and a Hybridization Oven/Shaker (former Amersham Biosciences). DNA labeling with Biotin-11-dUTP (Thermo Fisher Scientific, Waltham, MA, USA) was performed in a standard 50 μL PCR reaction with the necessary pairs of primers and templates, and 0.2 mM Biotin labeling mix and Taq DNA polymerase. The Biotin labeling mix consists of 2 mM dGTP, 2 mM dATP, 2 mM dCTP, 1.3 mM dTTP, and 0.7 mM Biotin-11-dUTP aqueous solution. Biotin chromogenic detection kits (Thermo Fisher Scientific, Waltham, MA, USA) were used to detect the DNA probes after Southern hybridization. The primer pairs used for the PCR amplification of the probes were P37/P38 for kan and P22/P23 for yECitrine (Table S1).

The main reagents used in this study include the reaction buffer and Bst enzyme (Isothermal Amplification Kit, Haitaizhengyuan, Beijing), the Biotin-11-dUTP (Thermo Scientific, Shanghai), the colorimetric indicators (Haitaizhengyuan, Beijing), the nanoparticle LFB, the LFB running buffer, the Nano drop ND-1000 (Calibre, Beijing, China) and a Loopamp Realtime Turbidimeter LA-320C (Eiken Chemical Co., Ltd., Japan.
The LFB was constructed according to the instructions by Wang et al.’s report^{14 (link)}. Briefly, the streptavidin-coated nanoparticles were adhered onto the conjugate pad. On the nitrocellulose membrane pad, there were three lines, including two test lines (conjugated with rabbit anti-fluorescein antibody and sheep anti-digoxigenin antibody, respectively) and one control line (conjugated with biotinylated bovine serum albumin). Finally, the assembled sample pad, conjugate pad, nitrocellulose membrane and the absorbent pad were cut (4 mm in width) and packaged in the plastic shells. The packaged biosensors were stored in dry environment at room temperature. The running buffer was the phosphate buffered saline (PBS) with the pH of 7.4.

For fluorescence in situ hybridization (FISH), three week old leaves were fixed in ethanol-acetic acid (3:1) and FISH was performed as described [72 (link)]. Centromeric repeat probes were amplified by PCR using Biotin-11-dUTP (Thermofisher) with primer TCTAGCACTTGTAATCAATCAAATTC and AGAAGTGAGAAGAAAGACTTG. To detect the probe, an anti-Biotin antibody (FITC) (ab53469, Invitrogen) was used at a concentration of 1/1000.

A total of 20 μg of genomic DNA was completely digested by proper restriction enzymes, and separated using agarose gel electrophoresis as previous described [22 (link)]. Gene-specific probes were amplified with primers listed in Table S1 and labeled with Biotin-11-dUTP (Thermo Fisher, Waltham, MA, USA, R0081). The chemiluminescence image analysis system (Tanon, St Andrew, UK, Tanon-4600SF) was used to detect the hybridization signals.

After deparaffinization, rehydration and antigen retrieval of 5 μm thick sections of Day 7, Day 14 and Day 20 spheroids, slides were incubated for 1.5 h at 37°C with a mix of 20 U/μL TdT (terminal deoxynucleotidyl transferase, Thermo Scientific), 1 mM biotin-11-dUTP (Thermo Scientific) and 1 mM ATP in TdT buffer. After washes, slides were incubated with streptavidin-HRP (Vector Laboratories, 1/500) at room temperature for 30 minutes. HRP was then detected with tyramide signal amplification following the manufacturer’s instructions (TSA-Alexa555, Invitrogen). Nuclei were counterstained with Hoechst 33342. Emitting fluorescence was detected using an Axioplan microscope (Zeiss), and images were recorded with an AxioCam MRs5 camera (Zeiss).

PCR was carried out in 50 μl reactions containing 1× GoTaq Flexi Colourless Buffer (Promega, Madison, WI, USA); 1.5 mM MgCl₂; 80 μM each dATP, dCTP and dGTP; 52 μM dTTP; 28 μM biotin-11-dUTP (Thermo Scientific, Waltham, MA, USA); 300 nM forward primer; 300 nM reverse primer; 1.25 units Go Taq polymerase (Promega) and 1 ng B. pseudomallei DNA. Primer combinations were as shown in Table 2. Cycling conditions were 95°C for 2 min, followed by 30 three-step cycles of 95°C for 30 s 58°C for 30 s and 72°C for 1 min, with a final extension step at 72°C for 5 min. After amplification, reactions were purified using the QIAquick PCR Purification kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and eluted in nuclease-free water. Approximate DNA concentrations of the purified PCR products were determined using a Qubit fluorometer and dsDNA HS Assay Kit (Life Technologies, Foster City, CA, USA) according to the manufacturer’s instructions. Approximate copy numbers were estimated on the basis of DNA concentration and the molecular weight of the predicted product. Each primer combination was initially tested in unlabelled PCR with dNTPs at 80 μM each and the products analysed by agarose gel electrophoresis to confirm the approximate size of the product and absence of primer dimers or other amplification artifacts (data not shown).