BM-MSCs were resuspended in antibiotic-free DMEM and re-seeded into 6-well plates at a density of 3×105 cells/well. BM-MSCs were incubated for 18–24 h and transfected using a Lipofectamine 2000 kit (Sigma-Aldrich; Merck KGaA). Liposomes, si-NC, si- X-inactive specific transcript (XIST), pcDNA-NC and pcDNA-XIST were all purchased from Shanghai Genechem (Shanghai, China). Detailed cell transfection was performed according to the instructions. siRNA at the concentration of 50 nM was added to each well and then incubated for 48 h. The sequences of the three si-XISTs were as follows: si-XIST 1#, 5′-GGCCTGTTATGTGTGTGATTATATT-3′; si-XIST 2#, 5′-GCCAACTGTCTGCTTAAGAAA-3′; and si-XIST 3#, 5′-GCTGCTAGTTTCCCAATGATA-3′.
Pcdna xist
Manufactured by Genechem
Sourced in China
PcDNA-XIST is a plasmid vector containing the XIST gene sequence. The XIST gene is responsible for the inactivation of one of the two X chromosomes in female cells. This plasmid can be used for studies related to X chromosome inactivation.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using pcdna xist
1
Transfection of BM-MSCs with XIST siRNA
2
Transfection of Lovo cells for XIST, miR-30a-5p, and ROR1 modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells at the density of 5 × 104/well were inoculated into 24‐well plates, with the culture medium free from antibiotics. When cells grew to 70% confluence, pcDNA‐XIST (Genechem, Shanghai, China), si‐XIST‐1 (sense: 5′‐GCAAAUGAAAGCUACCAAU‐3′, antisense: 5′‐AUUGGUAGCUUUCAUUUGC‐3′, Genechem, Shanghai, China), si‐XIST‐2 (sense: 5′‐GCACAAUAUCUUUGAACUA‐3′, antisense: 5′‐UAGUUCAAAGAUAUUGUGC‐3′, Genechem, Shanghai, China), si‐XIST‐3 (sense: 5′‐CUAGAAUCCUAAAGGCAAA3′, antisense: 5′UUUGCCUUUAGGAUUCUAG3′, Genechem, Shanghai, China), miR‐30a‐5p mimic (sense: 5′‐UGUAAACAUCCUCGACUGGAAG‐3′, antisense: 5′‐CUUCCAGUCGAGGAUGUUUACA‐3′, Ribobio, Guangzhou, China), miR‐30a‐5p inhibitor (sense: 5′‐CUUCCAGUCGAGGAUGUUUACA‐3′, anti‐sense: 5′‐UGUAAACAUCCUCGACUGGAAG‐3′, Ribobio, Guangzhou, China), pCMV6‐ROR1 (OriGene Technologies, Rockville, MD, USA), and si‐ROR1 (sense: 5′‐AUCCGGAUUGGAAUUCCCAUG‐3′, antisense: 5′‐CAUGGGAAUUCCAAUCCGGAU‐3′; sense: 5′‐CUUUACUAGGAGACGCCAAUA‐3′, anti‐sense: 5′‐UAUUGGCGUCUCCUAGUAAAG‐3′, Open Biosystem, Huntsville, AL, USA) were transfected into Lovo cells, according to the instructions of Lipofectamine3000 (Invitrogen, Carlsbad, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!