7500 fast pcr system

Manufactured by Thermo Fisher Scientific

Sourced in United States

The 7500 Fast PCR System is a real-time PCR instrument designed for rapid and efficient nucleic acid amplification and detection. It features a fast thermal cycling capability, allowing for quick reaction times. The system is capable of performing standard and fast PCR protocols.

Automatically generated - may contain errors

Lab products found in correlation

42 protocols using 7500 fast pcr system

Quantitative Analysis of Viral RNA and Cellular Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted from cells with TRIzol reagent according to the manufacturer’s instructions (Tiangen, China). DNase I (Thermo Scientific, USA) was used to digest single- and double-stranded DNAs. Reverse transcription-quantitative PCR (RT-qPCR) was performed to evaluate the mRNA expression levels of the relevant genes. Typically, 1 μg of total RNA was reverse transcribed into cDNA by using a reverse transcription kit (TaKaRa, Japan).
Real-time PCR was performed to evaluate viral genome quantification. Total DNA was extracted from infected cells and culture medium using a nucleic acid extraction kit (catalog number DP304; Tiangen). RT-qPCR and real-time PCR analyses were performed on a 7500 Fast PCR system (Applied Biosystems) using TB green premix ExTaq (TaKaRa). The primers used for RT-qPCR or real-time PCR are as follows: for IFN-β, F primer 5′-TGGAATGAGACTATTGTTGAGAA-3′ and R primer 5′-ATTTCCACTCTGACTATGGTC-3′; for IL-6, F primer 5′-TTCTCCACAAGCGCCTTCGGTC-3′ and R primer 5′-TCTGTGTGGGGCGGCTACATCT-3′; for U26, F primer 5′-TCTCGGTCTTGCTAAGGGTG-3′ and R primer 5′-CAGATCATGACCACTGCAGA-3′; for U22, F primer 5′-CGCTCGGAAAGGAAACATTA-3′ and R primer 5′-AAGTGGAACTGCTTGGTGGC-3′; and for actin, F primer 5′-TGGCACCCAGCACAATGAA-3′ and R primer 5′-CTAAGTCATAGTCCGCCTAGAAGCA-3′.

Jiang X., Tang T., Guo J., Wang Y., Li P., Chen X., Wang L., Wen Y., Jia J., Emanuela G., Hu B., Chen S., Yao K., Li L, & Tang H. (2021). Human Herpesvirus 6B U26 Inhibits the Activation of the RLR/MAVS Signaling Pathway. mBio, 12(1), e03505-20.

+ Open protocol

+ Expand

Quantitative analysis of Hedgehog pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from tissues or cell pellets using the high salt method. Absolute quantification was performed on Applied Biosystems 7500 Fast PCR System using SYBR Green reagents with an 8-point 5-fold serial dilutions standard curve and the following primers: 36B4-F ACTGGTCTAGGACCCGAGAAG, 36B4-R TCAATGGTGCCTCTGGAGATT, Atmin-F CAAGCACTCGGTGTCAATGG, Atmin-R CACAGTGCGCAGGCATCT. Total RNA was isolated from a cell pellet using RNeasy Mini kit and the RNase Free DNase set was used for on-column DNA digestion, according to manufacturer’s instructions. 750 ng of RNA was used as a template for cDNA synthesis with Superscript III First-Strand cDNA synthesis kit, according to manufacturer’s protocol. The following primers were used in Q-RT-PCR: Actin-F TCTTTGCAGCTCCTTCGTTG, Actin-R ACGATGGAGGGGAATACAGC, Dynll1-F GGCTGTCTTCTGCTGCTTG, Dynll1-R CATTTTTGATCACCGCCTTC, Gli1-F TGGAGGTCTGCGTGGTAGA, Gli1-R TTGAACATGGCGTCTCAGG, Ptch1-F GCTCTGGAGCAGATTTCCAA, Ptch1-R ACCCAGTTTAAATAAGAGTCTCTGAAA.

Foster H., Ruiz E.J., Moore C., Stamp G.W., Nye E.L., Li N., Pan Y., He Y., Downward J, & Behrens A. (2019). ATMIN is a tumor suppressor gene in lung adenocarcinoma. Cancer research, 79(20), 5159-5166.

+ Open protocol

+ Expand

Quantitative miRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from cells was isolated by the TRIzol reagent (Thermo Fisher Scientific) according to manufacturer’s instructions. For miRNA RT reaction, 1 μg of total cellular RNA or 150 ng of EV RNA was first converted into cDNA by Superscript III reverse transcriptase (Invitrogen), in which miRNA-specific stem-looped RT primers were used (miR-320c: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACCCTCTCAAC; U6: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAAATATGGAACG). For the quantitative determination of the reversely transcribed products, real-time PCR was performed on an Applied Biosystems 7500 Fast PCR System (Foster City, CA, USA) using the standard SYBR green method. For expression analysis, the Ct values of miRNA were first normalized to U6 genes in the same samples. The resulting ∆Ct was further utilized to assess the relative gene expression between different experimental groups, with the data presented as fold change to control. Sequences of primers used in real-time PCR assay are as follows: miR-320c, CGGCGGAAAAGCTGGGTTGAGAG; U6, CAAATTCGTGAAGCGTTCCA; universal reverse, CAACTGGTGTCGTGGAGTCGG.

Yang C.K., Hsu H.C., Liu Y.H., Tsai W.S., Ma C.P., Chen Y.T., Tan B.C., Lai Y.Y., Chang I.Y., Yang C., Yang C.Y., Yu J.S, & Liu H. (2022). EV-miRome-wide profiling uncovers miR-320c for detecting metastatic colorectal cancer and monitoring the therapeutic response. Cellular Oncology (Dordrecht), 45(4), 621-638.

+ Open protocol

+ Expand

Genetic Variant Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA extraction was performed with a MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics, Indianapolis, Indiana, USA) using Magna Pure LC 2.0® equipment from Roche. DNA samples were stored at −20 °C until analysis.
Genetic analysis was performed to assess four clinically relevant variants of the ABCB1 gene (rs3789243, rs1128503, rs2032582, and rs1045642), two variants of the CES1 gene (rs71647871 and rs2307243), one variant of the SLC15A1 gene (rs2297322), and one variant of the NEU2 gene (rs2233385). Allelic discrimination by real-time PCR was performed with specific primers and TaqMan® probes. Approximately 50 ng of genomic DNA was added to a master mix (Applied Biosystems, Foster City, CA, USA) that contained 200 nmol of primers and 40 nmol of probes for each polymorphism. Samples were placed in a 96-well plate and amplified as follows: pre-PCR read at 60 °C for 30 s, then 10 min at 95 °C, followed by 50 cycles of 95 °C for 15 s, and 60 °C for 1 min. Post-read analyses were performed at 60 °C for 30 s. All assays were carried out in a 7500 Fast PCR System (Applied Biosystems), and analyses were performed with 7500 Fast System SDS software.

Bermúdez de León M., León-Cachón R.B., Silva-Ramírez B., González-Ríos R.N., Escobedo-Guajardo B., Leyva-Parra R., Tovar-Cisneros B., González-González E., Alvarado-Díaz A., Vázquez-Monsiváis O., Mata-Tijerina V., Puente-Lugo L., Álvarez-Galván E., Currás-Tuala M.J., Aguado-Barrera M., Castorena-Torres F., Alcocer-González J.M., Elizondo G, & Salinas-Martínez A.M. (2020). Association study of genetic polymorphisms in proteins involved in oseltamivir transport, metabolism, and interactions with adverse reactions in Mexican patients with acute respiratory diseases. The Pharmacogenomics Journal, 20(4), 613-620.

+ Open protocol

+ Expand

Quantitative Analysis of Immune Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with TRIzol Reagent (Invitrogen, city, state). Complementary DNA (cDNA) was synthesized with SuperScript II reverse transcriptase (Invitrogen). Quantitative PCR (qPCR) primers were as follows: Arginase-1: Forward: 5′-CACGGCAGTGGCTTTAACCT-3′, Reverse: 5′-TGGCGCATTCACAGTCACTT-3′; iNOS: Forward: 5′-GGAATCTTGGAGCGAGTTGT-3′, Reverse: 5′- CCTCTTGTCTTTGACCCAGTAG-3′. IL-4Rα: Forward: 5′-CCTACACTACAGGCTGATGTTC-3′, Reverse: 5′-TGGACCGGCCTATTCATTTC-3′. mRNA was measured with a 7500 Fast PCR system (Applied Biosystems, Foster City, CA, U.S.) in duplicate and were normalized to GAPDH mRNA.

Xu Y., Zhao W., Xu J., Li J., Hong Z., Yin Z, & Wang X. (2016). Activated hepatic stellate cells promote liver cancer by induction of myeloid-derived suppressor cells through cyclooxygenase-2. Oncotarget, 7(8), 8866-8878.

+ Open protocol

+ Expand

Quantitative Analysis of HHV-6A Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from mock and HHV-6A-infected HSB-2 cells using TRIzol reagent (Invitrogen, USA), cDNA was generated using a PrimeScript II RT kit (Takara) according to manufacturer’s instructions. Quantitative RT-PCR was performed on a 7500 fast PCR System (Applied Biosystems) using the TB Green Premix Ex Taq (Takara). Data were normalized to the expression of β-actin. Additionally, viral DNA was extracted from HHV-6A-infected T cells and supernatants, respectively, and viral DNA was quantified using the U22 primer set. Quantitative PCR primer pairs are listed in S1 and S2 Tables.

Wu Z., Jia J., Xu X., Xu M., Peng G., Ma J., Jiang X., Yao J., Yao K., Li L, & Tang H. (2020). Human herpesvirus 6A promotes glycolysis in infected T cells by activation of mTOR signaling. PLoS Pathogens, 16(6), e1008568.

+ Open protocol

+ Expand

RNA Extraction and Genotyping Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was made using Trizol (Invitrogen). Reverse transcription was performed using the High-Capacity cDNA Reverse Transcription Kit (Invitrogen). Real time PCR was performed using the Applied Biosystems 7500 Fast PCR system using the Power SYBR Green PCR Master Mix (Applied Biosystems). Primer sequences are listed in Supplemental Table S1. Genotyping of DNMT3B7 mouse embryos was performed by real-time PCR using the TaqMan mastermix, using primers and probes as listed in Supplemental Table S1. Genotyping of Dnmt3b mouse embryos was performed by end-point PCR using the primers listed in Supplemental Table S1.

Vasanthakumar A., Zullow H., Lepore J.B., Thomas K., Young N., Anastasi J., Reardon C.A, & Godley L.A. (2015). Epigenetic control of Apolipoprotein E expression mediates gender-specific hematopoietic regulation. Stem cells (Dayton, Ohio), 33(12), 3643-3654.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the kidney samples or cells employing Trizol reagent (Invitrogen Life Technologies, Carlsbad, USA). cDNA synthesis was executed through a TaqMan reverse transcription kit (KR118-03, Tiangen, Beijing, China). Then, qRT-PCR was processed through a SuperReal PreMix Plus Kit (FP205, Tiangen, Beijing, China) on a 7500 FastPCR system from Applied Biosystems (Bio-Rad, USA). The sequences of each primer were presented in Supplementary Table 2. The relative mRNA levels were calculated by the 2^–ΔΔCT using GAPDH as a house-keeping gene.

Hu F., Yu Y., Lu F, & Cheng X. (2021). Knockdown of transient receptor potential melastatin 2 reduces renal fibrosis and inflammation by blocking transforming growth factor-β1-activated JNK1 activation in diabetic mice. Aging (Albany NY), 13(22), 24605-24620.

+ Open protocol

+ Expand

Genotyping of Hereditary Angioedema Patients

Check if the same lab product or an alternative is used in the 5 most similar protocols

We genotyped 139 patients diagnosed with C1-INH-HAE (mean age 38.9 years, range: 5–84 years, 76 females and 63 males). A Hungarian control population consisting of 160 healthy individuals was used for comparison as regards the prevalence of GR SNPs. Total genomic DNA was isolated from peripheral blood with a commercially available DNA isolation kit (QIAmp DNA Blood Mini Kit (Qiagen), according to the manufacturer’s instructions. The BclI and N363S polymorphisms were detected with allele-specific polymerase chain reaction (PCR), as described previously [14 (link), 29 (link)].
The A3669G polymorphism was measured with a predesigned TaqMan SNP Assay (C_8951023_10) (Applied Biosystems, LifeTechnologies), by real-time PCR, according to the recommended protocol, on a 7500 Fast PCR System (Applied Biosystems, LifeTechnologies).

Zotter Z., Nagy Z., Patócs A., Csuka D., Veszeli N., Kőhalmi K.V, & Farkas H. (2017). Glucocorticoid receptor gene polymorphisms in hereditary angioedema with C1-inhibitor deficiency. Orphanet Journal of Rare Diseases, 12, 5.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted in an RNase-free environment using TRIzol reagent (Invitrogen, United States), and cDNA was obtained using PrimeScript™ RT Master Mix (Takara Biotechnology Co., China) according to the manufacturer’s instructions. Real-time quantitative reverse transcription (RT-q) PCR was performed using the 7500 Fast PCR System (Applied Biosystems, CA, United States) with SYBR® Premix Ex Taq™ II (Takara Biotechnology Co., China). The reactions were carried out using the 20-μL reaction system per the manufacturer’s instructions. Moreover, glyceraldehyde-3-phosphate dehydrogenase was used as the housekeeping gene. The primer sequences were as follows: CIP2A (accession no. NM020890) sense 5’-GGCACTTGGAGGTAATTTCT-3’, anti-sense 5’-CTGGTTTCAATGTCTACTGCTAG-3’, glyceraldehyde-3-phosphate dehydrogenase (accession no. NM002046) sense 5’-AAGGCTGGGGCTCATTTG-3’, and anti-sense 5’-AGGAGGCATTGCTGATGATC-3’. All primers were provided by Takara Biotechnology Co. The expression of the reference gene glyceraldehyde-3-phosphate dehydrogenase was used to normalize the mRNA expression.

Zhao Y.X., Ma L.B., Yang Z., Wang F., Wang H.Y, & Dang J.Y. (2023). Cancerous inhibitor of protein phosphatase 2A enhances chemoresistance of gastric cancer cells to oxaliplatin. World Journal of Gastrointestinal Oncology, 15(2), 286-302.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!