Primescript rt reagent kit perfect
The PrimeScript RT reagent kit is a set of reagents designed for the reverse transcription of RNA into cDNA. The kit includes the necessary components for performing reverse transcription reactions, such as the PrimeScript reverse transcriptase enzyme and reaction buffer.
Lab products found in correlation
19 protocols using primescript rt reagent kit perfect
Quantification of CCNB1 Expression in LUAD Cells
Quantitative RT-PCR Analysis of Plant Gene Expression
Quantifying Endostatin and VEGF Expression
Quantitative RNA Analysis of Frankia Cells
Quantitative RT-PCR Analysis of Engineered Yeast Strains
Quantifying CAIII mRNA Expression in Muscles
Primer sequences for real-time PCR.
Amplification target | Primer end | Sequence |
---|---|---|
CAIII | 5′ | CTCTGGACCCTACCGACTTC |
3′ | CCAACCACAGCAATCCCATC | |
β-actin | 5′ | CTGTCCCTGTATGCCTCTG |
3′ | ATGTCACGCACGATTTCC |
CAIII = carbonic anhydrase III; PCR = polymerase chain reaction.
Extracting and Analyzing Tomato Leaf RNA
qPCR Analysis of Gene Expression
Transcriptional Analysis of Pseudogulbenkiania Strains
Evaluating Leaf Trait Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!