Amaxa mouse macrophage nucleofector kit

siRNAs specific to PPARγ were purchased from Dharmacon, USA (cat # L-040712-00-0005) while the scrambled siRNAmix was from Santa Cruz Biotechnology, USA. Mice were treated with LPS once over three consecutive days (10 μg each day) and lung MDSCs were isolated 1 day after last treatment and used for transfection (10⁶cells/transfection). Cells were transfected with either specific siRNA or scrambled siRNA using Amaxa Mouse Macrophage Nucleofector Kit from Lonza following manufacturer's instructions. Post-transfection, cells were maintained at 37 °C in the presence of 5% CO₂. The efficiency of gene knockdown was verified by qRT-PCR 24 h post-transfection.

Cells were transfected with either IL-10-luciferase reporter construct (Adgene) or PPRE-luciferase reporter construct (Qiagen, USA, Cat # CCS-3026L), using Amaxa Mouse Macrophage Nucleofector Kit from Lonza (Cat # VPA-1009) following manufacturer's instructions. Reporter assay was carried out 24 h post-transfection using dual luciferase assay kit (Promega, Cat # E1910) following manufacturer's protocol. Briefly, cells were washed with PBS followed by lysis with 1X passive lysis buffer. The lysate was cleared by brief centrifugation and firefly luciferase reporter activity in the clear supernatant was measured using a luminometer (Veritas, Promega). Renilla luciferase activity in the same lysate was used to assess transfection efficiency.

Frozen differentiated BMDMs were recovered and plated at a density of 5 × 10⁶ cells in a 10 cm dish (Falcon) in RPMI medium containing 10% (vol/vol) FBS and 10% (vol/vol) L‐cell conditioned supernatant. The next day, cells were lifted in cold PBS (Gibco) and resuspended in RPMI medium containing FBS (Swanson & Isberg, 1995). Resuspended cells were aliquoted into 1.5 ml microfuge tubes at 1 × 10⁶ cells per tube and pelleted by centrifugations for 10 min at 200g. Cell pellets were resuspended in nucleofector buffer (Amaxa Mouse Macrophage Nucleofector Kit [Lonza]) and 2 μg of siRNA was added to each tube (Dharmacon). Cells were transferred to a cuvette and nucleofected in the Nucleofector 2b Device (Lonza) under Y‐001 program settings. Nucleofected macrophages were immediately recovered in RPMI medium containing 10% FBS and 10% L‐cell supernatant. Cells were plated in 8‐well chamber slides (Millipore Sigma) for microscopy assays or in 12‐well plates (Corning) to prepare extracts for immunoblotting.

10⁶ microglial cells harvested were transfected with 1 μg of cDNA coding for TLR9-GFP^{38 (link)} using Amaxa Mouse macrophage nucleofector kit (Lonza), according to the manufacturer’s instructions. 3 h later, when the cells had adhered, the medium was changed to: DMEM containing 4% FCS, 2 mM glutamine (Gibco 25030-024), 50 μm 2mercaptoethanol, GM-CSF 0.1 μg ml⁻¹ (R&D Research 415). 24 h later, cells were stimulated with TLR9 agonist, CpG ODN.

The gRNA construct was constructed from a pSico lentiviral backbone driven by EF1a promoter expressing T2A flanked genes: puro and cherry. gRNAs were expressed from a mouse U6 promoter. Cloning of 20 nt gRNA spacer forward/reverse oligos was annealed and cloned via the AarI site.
3 μg of pooled gRNAs were electroporated using the Lonza Amaxa Mouse Macrophage Nucleofector kit (VPA-1009). Electroporated cells were then selected using puromycin 5 µg/mL and grown to 80% confluency. Limited dilution series were seeded in 96-well plate, let to grow for 3 weeks. Then the clonal cell lines were genotyped using: F:GCAGGAAATAACTTTTGTGGAGT and R:TGGGAGACAGAAAGCAGAAAG. Then this PCR product was sequenced, and KO efficiency was assessed using ICE Synthego (https://ice.synthego.com/#/). Then the hairpin structure was assessed by RNAfold (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi).

ON‐TARGETplus small interfering RNAs (siRNAs) for C/EBPε or Gfi‐1 were purchased from Dharmacon. Transfection of each siRNA into myeloid progenitor cells (5 × 10⁴) was performed using electroporation (mode: Y‐001; Nucleofector II/2b Device) with Amaxa Mouse Macrophage Nucleofector Kit (VPA‐1009; Lonza). The final concentration of the siRNAs was 20 nM. Transduced cells were used for ex vivo differentiation assay.