All lentiviral-shRNAs were constructed into pLV-H1-EF1α-puro vector following the manufacturer’s instruction (Biosettia). The indicated shRNA target sequences are: Ppm1b no. 1: 5′-ACAAGTGTGTGGATGGCAA-3′; Ppm1b no. 2: 5′-GGAGAGTAGAAATGGAAGA-3′; Ppm1b-L no. 1: 5′-GGCTAG AGCTGGCCTATAA-3′; Ppm1b-L no. 2: 5′-GAGGAGTGCTGAAAATATA-3′; Ppm1b-S no. 1: 5′-CTAAGGAAATACAGAGATA-3′; Ppm1b-S no. 2: 5′-TGCTGA ACATGAAGAGTAA-3′; hPpm1b no. 1: 5′-CAGTGGGAGTTATGATTTC-3′; hPp m1b no. 2: 5′-GGTGATTCACGTGCTGTTC-3′; Ppm1a no. 1: 5′-CCAAAGATGG AGAAGCATA-3′; Ppm1a no. 2: 5′-GAAGAAACATGGTGCAGAT-3′.
Plv h1 ef1α puro vector
Manufactured by Biosettia
Sourced in United States
The PLV-H1-EF1α-puro vector is a lentiviral expression vector. It contains the EF1α promoter for constitutive expression and the puromycin resistance gene for selection of transduced cells.
Automatically generated - may contain errors
Lab products found in correlation
Plv ef1 mcs ires bsd vector, by Biosettia (4 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (4 mentions)
Plv ef1α mcs ires bsd plasmid, by Biosettia (3 mentions)
Plv ef1α mcs ires bsd, by Biosettia (2 mentions)
Pcmv ha jmjd3, by Addgene (1 mentions)
0.45 μm filter, by Merck Group (1 mentions)
Mir 451a mimic, by RiboBio (1 mentions)
Gel imaging system, by Syngene (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Opti mem, by Corning (1 mentions)
293t cells, by Biosettia (1 mentions)
Puromycin, by Merck Group (1 mentions)
14 protocols using plv h1 ef1α puro vector
1
Lentiviral-shRNA Construction and Targeting Ppm1b/a
2
Lentiviral Gene Expression and Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For gene expression, the CDS of the target gene was amplified by reverse‐transcription PCR and then inserted into the pLV‐EF1α‐MCS‐IRES‐Puro/Neo cloning vector (Biosettia, USA) with indicated restriction enzymes. For gene silencing, single‐stranded shRNA was annealed and then ligated to the pLV‐H1‐EF1α‐Puro Vector (Biosettia, USA) according to the manufacturer's protocols. Recombinant lentiviruses were packaged and transduced into cells as described before.[69 ] shRNA sequences are listed in Table S3 , Supporting Information.
3
Lentiviral Vector Construction for UBE2N and SP1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We annealed shRNAs for UBE2N and SP1 and cloned them into the pLV-H1-EF1α-puro vector (Biosettia). The human cDNA fragment encoding UBE2N or SP1 was cloned into the pLV-EF1-MCS-IRES-Bsd vector (Biosettia). Lentiviral vectors and packaging plasmids were transfected into HEK293T cells via Lipofectamine 2000 reagent (Invitrogen) to generate lentiviruses. Primer sequences are provided in Supplementary Table 1 .
4
Lentiviral Knockdown of RNA-binding Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All lentivirus-shRNAs were inserted into a pLV-H1-EF1α-puro vector following the manufacturer’s instructions (Biosettia). The following shRNA target sequences were used:
SAMD4A: 5′-GCTCAGACTCTGTGGATTATG-3′;
SAMD4B: 5′-GGAGATGATGACACTGACTGA-3′;
4E-T-1: 5′-GCCTCTGTGAAGGAAGGTATA-3′;
4E-T-2: 5′-GCAAGTGGGACTTTGCCTTCT-3′;
CNOT6-1: 5′-GCATCTTTGTGGTCACTAA-3′; and
CNOT6-2: 5′-GCCATGATGCTTGTTTGCTTT-3′.
SAMD4A: 5′-GCTCAGACTCTGTGGATTATG-3′;
SAMD4B: 5′-GGAGATGATGACACTGACTGA-3′;
4E-T-1: 5′-GCCTCTGTGAAGGAAGGTATA-3′;
4E-T-2: 5′-GCAAGTGGGACTTTGCCTTCT-3′;
CNOT6-1: 5′-GCATCTTTGTGGTCACTAA-3′; and
CNOT6-2: 5′-GCCATGATGCTTGTTTGCTTT-3′.
5
Constructing JMJD3 and Oct4 Overexpression Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human JMJD3 expression plasmid pCMV-HA-JMJD3 was purchased from Addgene (Cambridge MA). To construct a human JMJD3 and Oct4 overexpression vector, human JMJD3 and Oct4 cDNA fragments were cloned into the pLV-EF1α-MCS-IRES-Bsd plasmid (Biosettia, San Diego, CA). The short hairpin RNA (shRNA) sequence for silencing human PHF20 (5′GCAGGAGGAGCTTCGCATATT3′) and human Oct4 (5′GCAACCTGGAGAATTTGTT3′) were designed using RNAi designer on the Invitrogen website. A scrambled sequence was used as a control for the knockdown analysis. The shRNAs were cloned into the pLV-H1-EF1α-puro vector (Biosettia). To establish stable cell lines, MDA-MB-231 and T47D cells were infected with lentiviruses carrying pLV-EF1a-JMJD3-IRES-Bsd (pLV-JMJD3) or the empty vector pLV-EF1α-MCS-IRES-Bsd (pLV-MCS) and then selected by 30 μg/ml blasticidin (Bsd) to generate stable cell lines with JMJD3 overexpression (MDA-MB-231-JMJD3 and T47D-JMJD3) or control cells (MDA-MB-231-MCS and T47D-MCS).
6
Cloning of CXCL12 and JMJD3 shRNA Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pCMV-JMJD3-HA vector was purchased from Addgene, Inc. The CXCL12 cDNA fragment from U87 ATCC cells was cloned into the Bam HI and XbaI restriction sites of the multiple cloning site of the pLV-EF1α-MCS-IRES-Bsd plasmid (BioSettia, Inc.) to generate the human CXCL12 expression plasmid. The short hairpin RNA (shRNA) sequence of JMJD3 (5′-GCATCTATCTGGAGAGCAAAC-3′) was searched and blasted using the BLOCK-iT™ RNAi Designer (https://rnaidesigner.thermofisher.com/rnaiexpress/ ), and a scrambled sequence (5′-GCTACACTATCGAGCAA-3′) was used as a control for knockdown analysis. The shRNA was cloned into the pLV-H1-EF1α-puro vector (BioSettia, Inc., San Diego, CA, USA).
7
Lentiviral Vector Generation for Zeb1 Knockdown and Overexpression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Zeb1-specific shRNA was annealed and subcloned into the pLV-H1-EF1α-puro vector (Biosettia). The Zeb1 cDNA sequence was subcloned into the pLV-EF1-MCS-IRES-Bsd vector (Biosettia). HEK293T cells were then cotransfected with lentiviral vectors and packaging plasmids using Lipofectamine 2000 reagent (Invitrogen) to generate lentiviral particles. Viral supernatants were collected 48 h after transfection, centrifuged at 75,000 × g for 90 min, resuspended and filtered through 0.45-μm filters (Millipore).
8
Lentiviral shRNA Construction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All lentiviral-shRNAs were constructed into pLV-H1-EF1α-puro vector or pLV-H1TetO-GFP-Bsd following the manufacturer’s instruction (Biosettia). The indicated shRNA target sequences were: RIP1 shRNA: 5′-GCATTGTCCTTTGGGCAAT-3′; RIP1 shRNA*: 5′-CCACTAGTCTGACTGATGA-3′.
9
Overexpression and Silencing of KDM6B
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression: The DNA sequence encoding human KDM6B was PCR-amplified from the plasmid pCMV-HA-KDM6B (Addgene, Cambridge, MA) and cloned into plasmid pLV-EF1α-MCS-IRES-Bsd (Biosettia, San Diego, CA). Gene silencing: short hairpin RNA (shRNA) sequences targeting KDM6B were cloned into the pLV-H1-EF1α-puro vector (Biosettia). Lentiviruses carrying the overexpression vectors, gene silencing vectors, or empty vectors were produced according to the manufacturer's instruction. To establish stable recombinant cell lines, lentivirus-containing medium was added to cells in the presence of 8 μg/mL polybrene for 48 h before selection with 10 μg/mL blasticidin or 1 μg/mL puromycin for 1 week.
10
Western Blotting and Plasmid Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blotting was performed in accordance with a previous protocol [18] . Briefly, proteins were loaded on 5-12% tris-acrylamide gels and membranes were blotted with specific antibodies. The LPIN1 antibody (Cat. 14906, Cell Signaling Technology, USA) was diluted to 1:1000. Bands were detected using a Gel imaging system (SYNGENE, USA).
Plasmid construction and transfection SMMC-7721, Hep3B, and HUVECs (3 × 10 5 cells/well) were seeded in 6-well plates, incubated overnight, and then transfected with miR-451a mimics (Ribobio Co., China) using Lipofectamine2000 (Invitrogen) and Opti-MEM (Corning) according to the manufacturer's instruction. Negative control (NC) is also purchased from Ribobio Co.
To construct the human LPIN1 overexpression vector, human LPIN1 cDNA was cloned from SMMC-7721 cells and ligated into pLV-EF1α-MCS-IRES-Bsd (Biosettia Inc., USA). For gene silencing, shLPIN1 DNA oligomers were annealed and cloned into pLV-H1-EF1α-puro vector (Biosettia Inc., USA). These sequences are listed in the supplementary materials section. Scrambled control (SC) sequences were used as in a previous report [16] .
Plasmid construction and transfection SMMC-7721, Hep3B, and HUVECs (3 × 10 5 cells/well) were seeded in 6-well plates, incubated overnight, and then transfected with miR-451a mimics (Ribobio Co., China) using Lipofectamine2000 (Invitrogen) and Opti-MEM (Corning) according to the manufacturer's instruction. Negative control (NC) is also purchased from Ribobio Co.
To construct the human LPIN1 overexpression vector, human LPIN1 cDNA was cloned from SMMC-7721 cells and ligated into pLV-EF1α-MCS-IRES-Bsd (Biosettia Inc., USA). For gene silencing, shLPIN1 DNA oligomers were annealed and cloned into pLV-H1-EF1α-puro vector (Biosettia Inc., USA). These sequences are listed in the supplementary materials section. Scrambled control (SC) sequences were used as in a previous report [16] .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!