Total DNA from fish scales with the same weight was extracted using a Universal Genomic DNA Purification Mini Spin Kit from Beyotime (D0063). And then the content of DNA extraction was detected. The collagen content of fish scales with the same weight was detected using a fish collagen (COL) ELISA kit from AiFang biological (AF69275-A).
Universal genomic dna purification mini spin kit
Manufactured by Beyotime
Sourced in China
The Universal Genomic DNA Purification Mini Spin Kit is a laboratory tool designed for the extraction and purification of genomic DNA from a variety of sample types. The kit utilizes a simple spin column-based method to efficiently isolate high-quality DNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Microrna reverse transcription kit, by Takara Bio (1 mentions)
Abi 7500 fast pcr system, by Toyobo (1 mentions)
Beyofast sybr green one step qrt pcr kit, by Beyotime (1 mentions)
Trizol reagent, by Beyotime (1 mentions)
Sybr green pcr master mix, by Toyobo (1 mentions)
Fast real time pcr system, by Roche (1 mentions)
D0063, by Beyotime (1 mentions)
One step tunel apoptosis assay kit, by Beyotime (1 mentions)
Sf9 cells, by Procell (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
T7 endonuclease 1 t7ei, by New England Biolabs (1 mentions)
Hieff clone plus multi one step cloning kit, by Yeasen (1 mentions)
Dh5α chemically competent cells, by Tsingke (1 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Ecori hf, by New England Biolabs (1 mentions)
Xhoi, by New England Biolabs (1 mentions)
Q5 polymerase, by New England Biolabs (1 mentions)
Transstart tip green qpcr supermix, by Transgene (1 mentions)
Cfx connect real time system, by Bio-Rad (1 mentions)
15 protocols using universal genomic dna purification mini spin kit
1
Fish Scale DNA and Collagen Analysis
2
Gene Expression Analysis via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Beyotime, Shanghai, China) was used to extract total RNA. BeyoFast™ SYBR Green One-Step qRT‒PCR Kit (Beyotime) was used to detect targeting gene according to the manual. In addition, for miRNAs, MicroRNA Reverse Transcription Kit (Takara Biotechnology, Japan) were used to perform reverse transcription. qRT-PCR was carried out on ABI 7500 fast PCR System (Carlsbad, CA, USA) with a SYBR green PCR Master Mix (TOYOBO, Japan). β-actin and U6 applied as internal references for mRNAs and miRNAs. The relative expressions were calculated with 2–ΔΔCT method. Moreover, genomic DNA (gDNA) was extracted by a Universal Genomic DNA Purification Mini Spin Kit (Beyotime) based on the manufacturer’s protocol. All primers were synthesized by GenePharma (Shanghai, China) and are listed in Table S2 .
3
Quantifying Mitochondrial DNA Copy Number
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative copy number of mtDNA was determined based on the ratio of mtDNA to nuclear DNA (nDNA) and measured by qPCR assay. Cytochrome b (Cyt B) and cytochrome c oxidase subunit II (COII) were used as controls for mtDNA, and GAPDH was used as a control for nDNA. The primer sequences (synthesized by Bao Biological Engineering Co., LTD, Dalian, China) are listed in Table 1 . Total DNA was extracted from renal tissues and podocytes with a universal genomic DNA purification mini spin kit (D0063, Beyotime Biotechnology) according to the manufacturer's instructions. A Talent quantitative real-time PCR (qPCR) kit (RR003Q, Bao Biological Engineering Co., Ltd., Dalian, China) was used to perform the qPCRs (5 min denaturation step at 95 °C, then 40 cycles of 10 s at 95 °C, 30 s at 60 °C and 30 s at 70 °C) using a Fast Real-Time PCR system (Roche, Switzerland). The 2−ΔΔCt method was used to calculate the relative expression.
Primer information
| Gene symbol | Primers | Sequence (5′ → 3′) | Gene ID | Product Length (bps) |
|---|---|---|---|---|
| COII | Forward | ACCTGGTGAACTACGACTGCTAGA | NC_005089.1 | 184 bp |
| Reverse | CCCTGGTCGGTTTGATGTTACTGT | |||
| Cyt B | Forward | TTCGCAGTCATAGCCACAGCATT | NC_005089.1 | 242 bp |
| Reverse | TGGAGGAAGAGGAGGTGAACGATT | |||
| GAPDH | Forward | GAAGGTGGTGAAGCAGGCATCT | NC_000072.7 | 116 bp |
| Reverse | CGGCATCGAAGGTGGAAGAGTG |
4
Mouse Tail DNA Amplification and Visualization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse tail DNA was extracted using a Universal Genomic DNA Purification Mini Spin Kit (Beyotime, D0063). Then, DNA was amplified with the primers 5′AATGGACCCTGTGCTTGGAGTG3′ (P1), 5′GGAGGAGGAGGTGGTCATAG AACG3′ (P2), 5′TCCTAATCCTTCCAAGCCGTTCTC3′ (P3), and 5′CAGCCATTTTGCCCATTT TGTGC3′ (P4). The PCR amplification program was set for predenaturation at 95 °C for 5 min, and then denaturation for 15 s at 95 °C, annealing at 58 °C for 15 s, and extension for 60 s at 72 °C in 35 cycles. The PCR products were electrophoresed in a 1% agarose gel and visualized under ultraviolet (UV) light at a wavelength of 300 nm.
5
Investigating Spodoptera exigua Apoptosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Spodoptera exigua (Hübner) were purchased from Henan Jiyuan Baiyun Industry Co., Ltd. Sf9 cells (S. frugiperda ovary cells), Thiazole blue (MTT) and Dimethyl sulphoxide (DMSO) were purchased from Wuhan Procell Life Technology Co., Ltd. One Step TUNEL Apoptosis Assay Kit and universal genomic DNA purification mini spin kit were purchased from Shanghai Beyotime Institute of Biotechnology.
6
Quantifying Mitochondrial DNA Content
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Min6 cells DNA was extracted using Universal Genomic DNA Purification Mini Spin Kit (Beyotime). MtDNA Content was represented with the ratio of relative abundancy of mitochondrial DNA and genomic DNA by PCR amplification primer sequence: mCОX2 mitochondria DNA, Forward: 5'-CCCGAОTAAATОAACCAACA-3', Reverse: 5'-CAATGGCCATAAACCTATGC-3'. mβ-globin genomic DNA, Forward: 5'-GAASCGATTCIACGGAGCAG-3', Reverse: 5'-GGACCAGCGATICTCAGTACA-3'.
7
Quantifying DNA Methylation in Lung Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extracted genomic DNA from the lung tissues by Universal Genomic DNA Purification Mini Spin kit (Beyotime, D0063) in accordance with the manufacturer's guidelines was spotted on PVDF membrane in 2 μl and subjected to dot-blot assay at 2-fold dilutions (0, 1, 2, 4, and 8 ng). The spots were air-dried at room temperature and then incubated with 5-methylcytosine (Novus, NBP2-42814, 1: 2,000) overnight at 4 °C with a shaking incubator. The membrane was then incubated with horse anti-mouse IgG-HRP (1:20,000) at room temperature on next day. Finally, the membrane was developed by BeyoECL Plus at room temperature in the dark for 5 min. Pro-plus 7.0 was used to assess DNA methylation levels.
8
Bisulfite DNA Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cellular genomic DNA was isolated with the Universal Genomic DNA Purification Mini Spin Kit (Beyotime). Bisulfite modification of DNA was performed with the DNA Bisulfite Conversion Kit (Beyotime) per the manufacturer’s directions. Bisulfite-treated DNA was amplified by PCR. The primers used were designed by MethPrimer (https://www.urogene.org/methprimer/ , Li and Dahiya32 (link)), and their sequences were described in Table S2 .
9
Telomere Length Measurement by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated using the Universal Genomic DNA Purification Mini Spin Kit (Beyotime). Telomere length was measured by the quantitative PCR (qPCR) method described by Cawthon.33 (link) qPCR was performed on the Roche LightCycler 480 System using the BeyoFast SYBR Green qPCR Mix (2×), with the “tel 1” and “tel 2” primer pair to amplify the telomere repeats (T), and the “36B4u” and “36B4d” primer pair to amplify the single copy gene (S) that serves as the internal reference. The primer sequences were listed in Table S2 . The thermal cycling profile for both amplicons began with a 95°C incubation for 1 minute for initial denaturation, followed by 40 cycles of 95°C for 10 seconds, 54°C for 15 seconds, and 72°C for 2 minutes. The relative telomere length was determined by the T/S ratio by the 2−ΔΔCT method.
10
Quantifying Genomic DNA Editing Efficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA (gDNA) was isolated using the Universal Genomic DNA Purification Mini Spin Kit (Beyotime, D0063, Shanghai, China). The resultant gDNA was used as a template for PCR with primers surrounding the sgRNA-UL8 and sgRNA-UL29 target sites. The following two pair primers were used for PCR amplification, named UL8-PCR-F, UL8-PCR-R, UL29-PCR-F, and UL29-PCR-R. Next, the PCR product was incubated with T7 Endonuclease I (T7EI) (NEB, M0302S, Ipswich, MA, USA) according to the specification, and cleavage was visualized with an agarose gel (1.5%). DNA was then digested with 5–10 units of T7EI for 30–60 min at 37 °C and resolved in an agarose gel. Quantification of gene disruption was performed using ImageJ software (NIH49) and calculated using Eqs. (1) and (2) :
These PCR products were also sequenced by Sanger sequencing and analyzed by Tracking of Indels by Decomposition (TIDE) (https://tide.nki.nl/ ).
These PCR products were also sequenced by Sanger sequencing and analyzed by Tracking of Indels by Decomposition (TIDE) (
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!