Dynabeads

The total RNA content was separated from 1 × 10⁶ cells using the TRIzol reagent (Invitrogen). The RNA m6A level was determined using the m6A RNA Methylation Quantification kit, and the absorbance value was analyzed using the SpectraMax Plus384 microplate Reader (Molecular Device, Sunnyvale CA, USA). Briefly, 150 µg of the total RNA content was dissolved in 500 mL of Rnase-free water and mixed with Biotinylated-Oligo (Promega) at room temperature for 10 min, followed by the addition of Streptavidin-Paramagnetic Particles (Promega). RNA containing polyA⁺ was separated from the solution using magnetic beads with biotin-streptavidin conjugate. The polyA⁺ enriched RNA was fragmented using the RNA Fragmentation Buffer (Millipore, Bedford, MA, USA). Dynabeads containing 5 µg of anti-m6A (at a dilution ratio of 1:1000; ab230356; Abcam) were used to bind to RNA fragments containing m6A methylation prior to the elution of RNA fragments from beads and overnight precipitation at 4°C. The enrichment of m6A in miR-20a-5p or pri-miR-20a-5p was detected using the provided primer-probe sets (Bogu Co., Ltd, Shanghai, China).

Exosomes were analyzed for the presence of surface marker CD63 by flow cytometry using magnetic coated CD63-Dynabeads (Thermo Fisher Scientific, Waltham, MA, United States, Cat No. 10606D) as per the manufacturer's instructions. Isolated exosomes were resuspended in 1 × PBS and bound to magnetic-coated CD63-Dynabeads (Thermo Fisher Scientific, Waltham, MA, United States) overnight at 4°C. The following day, the Dynabeads-bound exosomes were incubated with an anti-CD63 mouse antibody (Abcam, Cat No. ab59479) overnight at 4°C along with an appropriate isotype control. After incubation, the beads were washed two times with 1 × PBS and stained with Alexa Flour 488 anti-mouse secondary antibody (detection antibody) for 1 h at 4°C and analyzed by flow cytometry (Beckman Coulter DxFLEX Flow Cytometer).

TSP-1 was depleted from C57ACM by immunoprecipitation with an anti-TSP-1 antibody (Abcam, ab140250, 1:500) using magnetic Protein G Dynabeads (Invitrogen). Briefly, anti-TSP-1 antibody (Abcam 140250, 1:500) was incubated with Dynabeads with rotation for 10 min at room temperature. Then, C57ACM was added to the Dynabead-Ab complex, rotated for 10 min at room temperature, and immune complexes bound to the beads were pelleted by applying a magnetic field. The TSP-1-depleted ACM supernatant was collected and applied to neurons for 4 days. TSP-1 removal was verified by immunoblotting. For TSP-1 supplementation, ACM from P301SA was enriched with recombinant mouse TSP-1 (rTSP-1, 500 ng/ml, NovusBio) and the mixtures were added to cultured neurons for 4 days. Neuronal survival was determined by counting neurons identified by immunocytochemistry with anti-β-III-tubulin.

Nuclear protein extraction was performed as previously described.¹⁴ Protein G Dynabeads (Invitrogen) used for Immunoprecipitation (IP) were blocked with 1% bovine serum albumin (BSA) before the experiment. On the day of IP, nuclear proteins were dialysed into the BC200 buffer (20 mM HEPES, pH 7.9, 0.2 mM EDTA, 0.5 mM DTT, 20% glycerol, 0.2% NP‐40 and 200 mM KCl). Then, 5 µg p300 (ab14984; Abcam) or IgG control (ab157532; Abcam) was incubated with Dynabeads for at least 6 hours. 200 µg portions of nuclear proteins were diluted to a concentration of 200 ng/µL with BC200 buffer and precleared with Dynabeads for 2 hours, followed by incubation with Dynabeads‐antibody complex overnight. The beads were washed with BC200 and BC500, two times each. Finally, the beads were resuspended in 30 µL BC200 for subsequent experiments.

3 mg of Protein G Dynabeads (Life Technologies) were washed three times with 200 μl of PBST. After washing, 24 μg anti-β-tubulin rabbit polyclonal antibody (Abcam) was diluted in 0.1% PBST (200 μl) and incubated with the washed Dynabeads at 37°C for one hour with shaking at 1400rpm. Beads were washed three times with 200 μl of PBST, then conjugation buffer (20 mM Sodium Phosphate, 0.15 M NaCl, pH = 7–9) for crosslinking. Antibody was crosslinked to the Dynabeads using 250 μl of a freshly prepared solution of 5mM Bis (Sulfosuccinimidyl) substrate (BS³, Thermo Scientific) and incubated at room temperature for 30 min with shaking at 1400 rpm. The reaction was quenched by adding 1 M Tris HCl, pH = 7.5 (12.5 μl) for 15 min at room temperature. Beads were subsequently washed three times with 200 μl of 0.1% PBST.

Total RNA was extracted by TRIzol from PC9/GR cells. MeRIP assays were performed using a Magna MeRIP™ m6A Kit (17-10499, Millipore, MA) following the manufacturer’s recommendations. To enrich m6A-modified mRNA, DNA-free fragmented RNAs were incubated with specific antibody- or rabbit IgG (Millipore)-bound magnetic Dynabeads (Abcam). The locations of specific m6A sites in specific genes were predicted with RMBase v2.0 (http://rna.sysu.edu.cn/rmbase/) and SRAMP (http://www.cuilab.cn/sramp) (forward: GACTTCGTGCAAAGGGCCA; reverse: TGTGGTCCATTCTGGTGGAG). After RNA was extracted from cells, it was subjected to qRT-PCR using specific primers, and RNA levels were compared to the input (10%) RNA levels.