The chromatin immunoprecipitation assay was performed using the Thermo ChIP Kit (Invitrogen). Cells were cross-linked with 1% formaldehyde (final concentration) for 10 min at room temperature and terminated by adding glycine (1.25 M). After being washed twice using ice-cold PBS, cells were harvested in cell scraper and then resuspended with lysis buffer. The cell suspension was sonicated to fragments of 500 base pairs in length. The lysate was pre-cleared by incubation with protein G agarose and incubated overnight at 4 °C with either anti-ATF3 antibody (Santa Cruz Biotechnology) or non-immune IgG (Upstate Biotechnology, Inc.). To collect the immunoprecipitated complexes, protein G magnetic beads were incubated. After purified, DNA samples were amplified in a 7500 quantitative real-time PCR System (Applied Biosystems, Carlsbad, CA) and quantitated in triplicate by SYBR Green qPCR (Bio-Rad, CA, USA). The primer sequences that targeted mouse NFATc1 promoter are as follows: forward 5′TACAGCAAGCAATCCAGTTC 3 ′, reverse 5′ TCCCATCCCGCTAAATTACT3 ′. Data were analyzed using the 2−△△CT method.
7500 real time quantitative pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 7500 real-time quantitative PCR system is a laboratory instrument used for performing real-time polymerase chain reaction (qPCR) analysis. It enables the detection and quantification of specific DNA or RNA sequences in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Thermo chip kit, by Thermo Fisher Scientific (2 mentions)
Sybr green qpcr master mix, by Thermo Fisher Scientific (2 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Anti atf3 antibody, by Santa Cruz Biotechnology (1 mentions)
Anti klf15 antibody, by Santa Cruz Biotechnology (1 mentions)
3500xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna ffpe tissue kit, by Qiagen (1 mentions)
5 mm stainless steel bead, by Qiagen (1 mentions)
Tissuelyser, by Qiagen (1 mentions)
Primescript reverse transcriptase reagent kit, by Takara Bio (1 mentions)
Sybr green detection system, by Roche (1 mentions)
Qiaamp viral rna mini kit, by Qiagen (1 mentions)
Revert aid first strand complementary dna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Primescript rt kit, by Takara Bio (1 mentions)
Rt master mix, by Takara Bio (1 mentions)
Prism 9, by GraphPad (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
12 protocols using 7500 real time quantitative pcr system
1
ChIP Assay for ATF3 Binding
2
ChIP Assay for Transcription Factor Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was done as described 27 (link), 29 (link) using the Thermo ChIP Kit (Invitrogen). Cells (2x106) were crosslinked with a 1% formaldehyde solution for 10 min and terminated by adding lycine 1.25 M). After being washed twice using ice-cold PBS, cells were harvested in cell scraper and then lysed in 200 μL of SDS lysis buffer, and sonicated to generate 300 to 800 bp DNA fragments. The lysate was pre-cleared by incubation with protein G agarose and incubated overnight at 4 °C with either anti-KLF15 antibody (Santa Cruz Biotechnology) or non-immune IgG (Upstate Biotechnology, Inc.). To collect the immunoprecipitated complexes, protein G magnetic beads were incubated. After purified, DNA samples were amplified in a 7500 quantitative real-time PCR System (Applied Biosystems, Carlsbad, CA) and quantitated in triplicate by SYBR Green qPCR (Takara Biotechnology, Dalian, China) using forward and reverse primer sequences (Supplementary Table S3 ) for the mouse flot2 promoter. Data were analyzed using the 2-△△CT method.
3
Comprehensive Genomic Profiling of Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Formalin‐fixed, paraffin‐embedded (FFPE) tissue blocks were reviewed for quality control, and the regions containing more than 50% of tumor cells were selected for macrodissection. Genomic DNA was extracted using the QIAamp DNA FFPE Tissue kit (QIAGEN, Hilden, Germany). Direct sequencing of KIT (exons 9, 11, 13, 17, and 18), NRAS (exons 2 and 3), BRAF (exon 15), TERT (promoter region), and GNAQ and GNA11 (exons 4 and 5) were performed using the Big Dye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA) in accordance with the manufacturer's instructions for the 3500XL Genetic Analyzer (Applied Biosystems). The primer sequences are listed in supplemental online Table 2 . Mutations in BRAF exon 15 V600E were identified by the 7500 real‐time quantitative PCR system (Applied Biosystems) using the minor groove binder (MGB) probes. Primers and probes for the V600E assay were as follows: forward: 5’‐ATGAAGACCTCACAGTAAAAATAGG‐3’; reverse: 5’‐AGACAACTGTTCAAACTGATGGG‐3’; mutation anchor: FAM‐TCTAGCTACAGAGAAA‐MGB; wild anchor: HEX‐TCTAGCTACAGTGAAA‐MGB.
4
Bacterial RNA Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from bacteria (0.1 g) using TRIzol reagent. RNA was converted to cDNA using a reverse transcription kit. Gene expression was determined using qPCR SYBR Green Master Mix and the 7500 real-time quantitative PCR system (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). 16S was used for normalisation. Relative quantification of the target genes was performed using the 2−ΔΔCT method. The forward and reverse primers of buk were 5ʹ-TGCTGTWGTTGGWAGAGGYGGA-3ʹ and 5ʹ- GCAACIGCYTTTTTTGATTTAATGCATGG-3ʹ. The forward and reverse primers of 16S were 5ʹ-CCTACGGGNGGCWGCAG-3ʹ and 5ʹ-GACTACHVGGGTATCTAATCC-3ʹ.
5
Quantifying Mitochondrial DNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmids expressing the wildtype, c.571C>T and c.1259delG mutants of MSTO1 were transfected to HEK293T cells, respectively, as described above. The total genomic DNA of the harvested cells was extracted using the QIAamp DNA blood mini kit (Qiangen, Germany). Relative mtDNA copy number was analyzed using the 7500 real-time quantitative PCR System (Applied Biosystems, Foster, CA, USA) and SYBR Green qPCR Master Mix (K0241, Thermo Fisher Scientific, Waltham, MA, USA). Nuclear-encoded housekeeping gene 18S was measured for internal control. The primer sequences specific to mtDNA and 18S were used as described previously (18 (link)). At least three independent biological experiments were replicated and statistical significance was determined by unpaired 2-tailed Student's t-tests.
6
Quantification of MMP-13 and Collagen I Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse skin samples were homogenized and total RNA was extracted at 4℃ in TRIZOL reagent (Ambion-Thermo Fisher Scientific, MA, USA) using TissueLyser (Quiagen, Valencia, CA, USA) and 5 mm stainless steel beads (Qiagen, Valencia, CA, USA). The isolated RNA was reverse-transcribed into cDNA using the PrimeScript™ Reverse Transcriptase reagent kit (Takara Bio Inc., Otsu, Japan) according to the manufacturer's instructions. The mRNA expression of MMP-13 and typeⅠ collagen (Collagen Ⅰ)was determined using a 7500 real-time quantitative PCR system (Applied Biosystems, Foster City, USA) and a SYBR green detection system (Roche, Mannheim, Germany). PCR was performed using the following primers: MMP-13 (mouse) forward 5′-CAT CCA TCC CGT GAC CTT AT-3′, and reverse 5′-GCA TGA CTC TCA CAA TGC GA-3′; Collagen I (mouse) forward 5′-TCG TGA CCG TGA CCT TGC G-3′ and reverse 5′-GAG GCA CAG ACG GCT GAG TAG-3′; 36B4 (endogenous reference) forward, 5′-TGG GCT CCA AGC AGA TGC-3′, and reverse, 5′-GGC TTC GCT GGC TCC CAC-3′. Data were analyzed using the 2−ΔΔCT method [27 (link)] and expressed as fold changes of gene expression relative to 36B4.
7
Viral RNA Detection by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted using the QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany) following the protocol of the manufacturer after tissues were ground by a freeze-grinding machine (60 MHz, 2 min) (HODER Beijing N. 9548R). One-step nucleic acid detection kit (DaAn Gene, Guangzhou, China) was used to detect the RNA genome, which was determined by absolute RT-qPCR on a 7500 Real-time Quantitative PCR System (Applied Biosystems, Foster City, USA) under the following program, namely, 1 cycle at 50°C for 15 min, 95°C for 15 min; 40 cycles at 94°C for 15 s, and 55°C for 45 s. The number of viral RNA copy was calculated by generating a standard curve as previously described (Li et al., 2017 (link)). Viral RNA copy number was expressed as log10 RNA copies per μl.
8
Quantifying Gene Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells and snap-frozen liver tissues using the TRIzol reagent (cat# 15596026; ThermoFisher Scientific) and reverse-transcribed into complementary DNA using the RevertAid first-strand complementary DNA synthesis kit (cat# k1622; ThermoFisher Scientific). Real-time quantitative PCR was performed using PowerUp SYBR Green Master Mix (cat# a25742; ThermoFisher Scientific) and Applied Biosystems 7500 real-time quantitative PCR system (Foster City, CA). Relative mRNA expression was normalized to Gapdh mRNA levels. The primer sequences are listed in Table 2 .
9
Quantifying Gene Expression in Rat Lungs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from rat lung tissue samples and reverse transcribed using a PrimeScript RT kit (Takara). All RT-PCRs were performed on an Applied Biosystems 7500 real-time quantitative PCR system. Data from different samples were normalized using Gapdh as an internal control. The primers used for RT-PCR were showed in Additional file 1 : Table S1.
10
Quantitative Real-Time PCR Analysis of Candidate Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR was used to analyze the specific expression of candidate genes. We extracted total RNA from seeds at different stages and plant tissues (stems, leaves, and male and female flowers) at the flowering stage, and the RNA was reverse transcribed into cDNA using the reverse transcriptase RT Master Mix (Takara, Beijing, China), following the manufacturer’s protocol. The primer sequences (Supplemental Table S1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!