Rneasy maxi prep kit

15*10⁶ COS-7 cells were cultured in DMEM (ThermoFisher Scientific; 31966–021) supplemented with 10% FBS (ThermoFisher Scientific; 10270–106) and 1% Pen/Strep (ThermoFischer Scientific; 15070–063). Cells were transfected with 150 µg library DNA and 75 µg of pcDNA (control), SG4 (15 µg Smad1, 15 µg Smad4, 30 µg Alk3 and 15 µg Gata4 expression vectors) or Wnt (15 µg Tcf4 expression vector, 60 µg pcDNA, and 0.4M LiCl) using Polyethylenimine 25 kDa (PEI; Sigma-Aldrich; 408727) in a ratio of 1:3 (DNA:PEI). Medium was refreshed 6 hr after transfection. 48 hr after transfection, total RNA was isolated using the Qiagen RNeasy maxi prep kit (Qiagen; 75162). polyA+ RNA was isolated using Dynabeads Oligo-dT₂₅ (ThermoFisher Scientific; 61002) and treated with Ambion turboDNase (ThermoFisher Scientifc; AM2238) for 30 min at a maximum concentration of 150 ng/µl. RNA was purified using the Qiagen RNeasy MinElute kit (Qiagen; 74204). First-strand cDNA synthesis and library preparation was performed as described (Arnold et al., 2013 (link)). Library quality and concentration were assessed by Bioanalyzer (Agilent) and KAPA Library Quantification Kit (KAPA Biosystems; KK4824). Libraries were pooled equimolarly and sequenced on an Illumina MiSeq (PE150).

Twenty-four hours post-electroporation cells were washed in 1 × PBS and harvested. Total RNA was extracted from all surviving cells using a Qiagen RNeasy maxi prep kit (QIAGEN, 75162), eluted with 1.5 mL nuclease-free water (Ambion, AM9938). The poly(A)-positive RNA was isolated using a Dynabeads mRNA Purification Kit (Life Technologies, 61006) following the manufacturer’s instructions. Then the mRNA was treated with TURBO DNase (Life Technologies, AM1907) for 30 minutes at 37 °C, followed by DNase inactivation and purification according to the kit protocol. Finally, the purified mRNA was quantified by NanoDrop 2000.
First strand cDNA synthesis was performed with SuperScript® III First-Strand Synthesis SuperMix (Life Technologies, 18080400) using a reporter RNA specific primer (5′ CAAACTCATCAATGTATCTTATCATG) and 450–500 ng mRNA per reaction for a total of 30 reactions. Five reactions were pooled (100 μL) and incubated at 37 °C for 1 h after adding 1 μL of 10 mg/mL RNaseA and 1 μL RNaseH (NEB, M0297).