The largest database of trusted experimental protocols

Revertra ace α qpcr rt kit

Manufactured by Toyobo
Sourced in Japan

The ReverTra Ace‐α qPCR RT Kit is a lab equipment product manufactured by Toyobo. It is designed for reverse transcription and quantitative PCR (qPCR) analysis. The kit includes necessary reagents for the reverse transcription of RNA into cDNA, which can then be used as a template for qPCR amplification and quantification.

Automatically generated - may contain errors

2 protocols using revertra ace α qpcr rt kit

1

Quantification of miRNA and mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
TRIzol Reagent (Life Technologies) was used to extract total RNA according to the manufacturer's protocol. RNA was quantified and reverse transcribed into cDNA using the ReverTra Ace‐α qPCR RT Kit (Toyobo, Japan). RT‐PCR of the mature miRNAs was performed using miRcute miRNA First‐Strand cDNA Synthesis Kit (Tiangen, Beijing, China). According to the user guide of the SYBR® Green Realtime PCR Master Mix (Toyobo, Japan), the qRT‐PCR amplification was done on ABI7500 Fast system. Melting curve analysis was used to monitor the specificity of the PCR products. GAPDH was used as a control. The HCP5 primers were as follows: forward, 5′‐GACTCTCCTACTGGTGCTTGGT‐3′; reverse, 5′‐CACTGCCTGGTGAGCCTGTT‐3′. The BIRC3 primers were as follows: forward, 5′‐CCAAGTGGTTTCCAAGGTGT‐3′; reverse, 5′‐TGGGCTGTCTGATGTGGATA‐3′. The GAPDH primers were as follows: forward, 5′‐CGGAGTCAACGGATTTGGTCG‐3′; reverse, 5′ ‐TCTCGCTCCTGGAAGATGGTGAT‐3′. The miR‐219a‐5p primers were as follows: 5′‐GCTGATTGTCCAAACGCAATTCT‐3′; U6 was used as a control and the primers were as follows: forward, 5′‐CTCGCTTCGGCAGCACA‐3′; reverse, 5′‐AACGCTTCACGAATTTGCGT‐3′. All of these primers were purchased from Sangon Biotech, Shanghai, China. All experiments were performed in triplicate. The qRT‐PCR results were analyzed and expressed as relative miRNA or mRNA levels of the CT (cycle threshold) value and then were converted to fold change.
+ Open protocol
+ Expand
2

Quantitative real-time PCR protocol for gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from tissues and cells using TRIzol reagent (Invitrogen, Carlsbad, CA) following manufacturer’s protocol. The RNA was reverse transcribed into first stranded cDNA using ReverTra Ace-α qPCR RT Kit (Toyobo, Osaka, Japan). The qPCR was performed using SYBR Green Master Mix (Roche, Basel, Switzerland) on a CFX96 system (Bio-Rad, Hercules, CA). GAPDH and U6 were used as internal controls for mRNA and miRNA respectively. The relative expression of gene was calculated using 2−ΔΔCT [27 (link)]. The primer sequences were listed in Table 1.

Sequence of primers

PrimerSequence
MIAT-F5′-GCACCTTGAGTGAATGTCAAGGCAG-3′
MIAT-R5′-TGGCAGCATCCAGCCGACACACAGG-3′
LASP1-F5′-TGCGGCAAGATCGTGTATCC-3′
LASP1-R5′-GCAGTAGGGCTTCTTCTCGTAG-3′
COLCA1-F5′-CTTATGACAGGAAAGTGGAAG-3′
COLCA1-R5′-TAGCATCAAGTTCCCATCCAC-3′
SHNG14-F5′-TGCACAAAATAAGCCTGGCTGT-3′
SHNG14-R5′-TCAATATTTAATACAGGCATGCA-3′
SHNG15-F5′-TTCAGACAATGACTTCCTCCCTCCT-3′
SHNG15-R5′-TAGCTCCTGGGGCACTCAGCTC-3′
RNU12-F5′-TGCCTTAAACTTATGAGTAAGG-3′
RNU12-R5′-GGGCCGGACTTATCTTTCTGAA-3′
LINC00667-F5′-CTGAAATCACAGCAATGCCAGTTT-3′
LINC00667-R5′-TATAGCTTTGATTTTCTTGCAGTGT-3′
GAPDH-F5′-TTTGGTCGTATTGGGCGCCTGGTCA-3′
GAPDH-R5′-TTGTGCTCTTGCTGGGGCTGGTGGT-3′
Stem-loop5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCAGCA-3′
miR-324-3p-F5′-GCCGAGCCCACTGCCCCAGG-3′
miR-324-3p-R5′-CTCAACTGGTGTCGTGGA-3′
U6-F5′-CTCGCTTCGGCAGCACA-3′
U6-R5′-AACGCTTCACGAATTTGCGT-3′
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!