Mutagenesis kit

Manufactured by Toyobo

Sourced in Japan

The Mutagenesis kit is a laboratory equipment designed for the introduction of specific genetic modifications in DNA sequences. It provides the necessary components and protocols for scientists to perform targeted mutagenesis experiments.

Automatically generated - may contain errors

Lab products found in correlation

Pcmv6 xl5 vector, by OriGene (1 mentions) Pebmulti bsd vector, by Fujifilm (1 mentions) Pcmv flag4, by Merck Group (1 mentions) Kod plus dna polymerase, by Toyobo (1 mentions) Prescission protease, by Cytiva (1 mentions) Glutathione sepharose 4b column, by Cytiva (1 mentions) Pgex 6p 1 vector, by Cytiva (1 mentions)

6 protocols using mutagenesis kit

Cloning and Mutagenesis of PITX1 and ZCCHC10

Check if the same lab product or an alternative is used in the 5 most similar protocols

FLAG-tagged PITX1 expression plasmids were as described previously [29 (link)]. pFLAG-ZCCHC10 was constructed by amplification of ZCCHC10 cDNA from IMR90 cDNA by PCR using KOD plus DNA polymerase (TOYOBO, Osaka, Japan) and the following primer sequences; forward primer: 5'- GAAGATCTTATGGCGACTCCCATGCATCGGCTAA, reverse primer: 5'- GGGGTACCCTATTTCTTTTTCTTCTTCTTTGGT. Sequences were inserted into the BglⅡ/Acc65I (TOYOBO) digested FLAG-tagged vector pCMV-FLAG4 (Sigma). pCMV-FLAG4 was used as a control.
Non-tagged PITX1 or ZCCHC10 expression vector was inserted into the pCMV6-XL5 vector (Origene, Rockville, MD, USA) or pEBMulti-Bsd vector (Wako, Tokyo, Japan). PITX1 ΔHD1, ΔHD2, ΔOAR and ZCCHC10 ΔCCHC expression plasmids were established using a mutagenesis kit (TOYOBO), according to the manufacturer's instructions. The following primer sequences were used; PITX1 ΔHD1 forward primer: 5'-CGCGAGCGTAACCAGCAGCTGGAC, reverse primer: 5'-GCTCATGTCGGGGTAGCGGTTCCT, PITX1 ΔHD2 forward primer: 5'- ATGAGGGAGGAGATCGCCGTGTGG, reverse primer: 5'- CTGCTTCTTCTTCTTGGCTGGGTC, PITX1 ΔOAR forward primer: 5'- TTTGGCTACGGCGGCCTGCAGGGC, reverse primer: 5'- GTAGACGCTGTAGGGCGAGGCGGG, ZCCHC10 ΔCCHC forward primer: 5'- ACAGGAAAAAGAAAATACCTACAT, reverse primer: 5'- TCTTACATGTTGCTTATTTGCTTC.

Ohira T., Kojima H., Kuroda Y., Aoki S., Inaoka D., Osaki M., Wanibuchi H., Okada F., Oshimura M, & Kugoh H. (2019). PITX1 protein interacts with ZCCHC10 to regulate hTERT mRNA transcription. PLoS ONE, 14(8), e0217605.

+ Open protocol

+ Expand

Pseudovirus-based Entry Assays for IAV, VSV, Ebola, SARS-CoV, and SARS-CoV-2

Check if the same lab product or an alternative is used in the 5 most similar protocols

For IAV, VSV and Ebola entry assays, pseudovirus based on HIV were prepared as previously reported.²⁷ Briefly, HEK 293T cells were transfected with pNL4‐3‐luc R^‐E^‐ and IAV HA/NA, VSV‐G or Ebola‐GP expressing plasmid. The HA and NA expression vectors of A/chicken/Hubei/327/2004(H5N1) and A/Anhui/1/YK_RG25/2013(H7N9) were gifts from Yi Shi (Institute of Microbiology, Chinese Academy of Sciences). For SARS‐CoV and SARS‐CoV‐2 entry assays, pseudovirus based on murine leukaemia virus (MLV) were prepared by transection of HEK293T with spike protein expressing plasmid, pCgp and pRV107G‐luc. The SARS‐CoV and SARS‐CoV‐2 spike protein expression vectors were constructed by PCR from the pcDNA3.1‐SARS‐S‐P2A‐eGFP and pcDNA3.1‐SARS‐CoV‐2‐S‐P2A‐eGFP (Molecular Cloud No. MC_0101088 and MC_0101087) with 19aa deletion in C‐terminator. The mutant SARS‐CoV‐2 spike expression vectors were constructed by PCR from wild‐type (WT) spike expression vector with mutagenesis kit (TOYOBO).

Du X., Zuo X., Meng F., Han C., Ouyang W., Han Y., Gu Y., Zhao X., Xu F, & Qin F.X. (2020). Direct inhibitory effect on viral entry of influenza A and SARS‐CoV‐2 viruses by azithromycin. Cell Proliferation, 54(1), e12953.

+ Open protocol

+ Expand

Functional Analysis of C3 Variant

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

As C3 p.W1034R was considered the most probable candidate variant for a causative mutation in this family with aHUS (Zhao et al., 2020 (link); Table S1), a functional analysis was conducted using a recombinant glutathione S‐transferase (GST)‐tagged C3 protein in which the amino acid at the 1034 position was substituted with arginine to demonstrate the functional effects of the variant (Supplementary Methods). Briefly, the PCR‐amplified fragments of C3 from 3004 to 3909 (Figure 2a), corresponding to C3d, were inserted into the pGEX6P‐1 vector (Cytiva, Tokyo, Japan), and the recombinant GST‐tagged C3d protein was expressed and purified using a glutathione Sepharose 4B column (Cytiva, Tokyo, Japan). Subsequently, the GST tag was removed by overnight incubation with PreScission Protease (Cytiva, Tokyo, Japan) at 4°C. A 3100T>C mutation in C3d introduced into the pGEX6P‐1 vector was induced using a mutagenesis kit (Toyobo, Osaka, Japan). As controls that had been reported to have deleterious effects on the binding between C3b protein and factor H (Schramm et al., 2015 (link)), the vectors harboring the 3187 A > C mutation, which leads to an amino‐acid substitution of serine to arginine (S1063R), and the 3281 C > A mutation, which leads to an amino‐acid substitution of alanine to aspartate (A1094D), were also constructed.

Tsuchida M., Goto S., Watanabe H., Goto S., Yamaguchi H, & Narita I. (2023). Defective C3d caused by C3 p.W1034R in inherited atypical hemolytic uremic syndrome. Molecular Genetics & Genomic Medicine, 12(1), e2288.

+ Open protocol

+ Expand

Generation of NR0B1/DAX1 L295H Mutant

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human full-length NR0B1/DAX1 (Origene), NR5A1/SF1 (GenScript) and EGR1 (Addgene) plasmid vectors were commercially obtained. DAX1 cDNA containing the L295H mutation was created by mutagenesis kit (Toyobo, Osaka, Japan) with the following pairs of primers containing the appropriate nucleotide substitutions (CTC to CAC). 5′- CACATGCTTGAGCTGGCCCAGGACCGCT -3′, 5′- CAGGGACGCCCAGCAGTTGCGCACC -3′. The accuracy of the constructions was confirmed by direct sequencing.

Hasegawa Y., Takahashi Y., Kezuka Y., Obara W., Kato Y., Tamura S., Onodera K., Segawa T., Oda T., Sato M., Nata K., Nonaka T, & Ishigaki Y. (2020). Identification and Analysis of a Novel NR0B1 Mutation in Late-Onset Adrenal Hypoplasia Congenita and Hypogonadism. Journal of the Endocrine Society, 5(2), bvaa176.

+ Open protocol

+ Expand

Plasmid Construction and Colony Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pGIPZ-shHAAO-1, pGIPZ-shHAAO-2, pGIPZ-shHAAO-3, pGIPZ-shDUSP6-1, pGIPZ-shDUSP6-2, pGIPZ-shYY1-1 and pGIPZ-shYY1-2 were purchased from SHSMU DNA Library. The pTSB-KMO was purchased from Genewiz. pLenti-HA-YY1-WT was constructed by PCR using primers WT-F: CCGGAATTCATGTACCCATACGACGTCCCAGACTACGCTGCCTCGGGCGACAC and WT-R: CGCGGATCCTCACTGGTTGTTTTTGGCCTTAGC. The YY1-T398A and YY1-T398E mutant vectors are obtained using mutagenesis kit (TOYOBO, cat: SMK-101) and primers YY1-F-T398E: gtttgctcagtcaGAAaacctgaaatctcacatc, YY1-F-T398A: gtttgctcagtcaGCAaacctgaaatctcacatc and YY1-Rmut: ttcttattacaaccatcgaaggggcacac. For the construction of pET-28a(+)-YY1, a BamHI/EcoRI fragment encompassing the CDS of human YY1 (NM_003403.4) was ampli ed from human cDNA by PCR using primers YY1-F: CGGGATCCATGGCCTCGGGCGACACCC and YY1-R: CCGGAATTCTCACTGGT TGTTTTTGGCCTTAGCA, and the fragment was inserted into pET28a(+) vector for bacterial expression.
Colony formation HCC cells were seeded into 6-well dishes at a cell density of 1000 cells/well and treated with drugs for 10-14 days until clones were visible. PBS-washed cells were xed with 4% paraformaldehyde and stained with 1% crystal violet. The stained clones were counted.

Shi Z., Gan G., Gao X., Chen F., & Mi J. (2021). 3-HAA Metabolic Pathway Regulates HCC Growth.

+ Open protocol

+ Expand

Recombinant AGR2 Protein Purification and Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

In-house recombinant human AGR2 (His-AGR2) was purified by Ni affinity chromatography from E. coli (Escherichia coli) expressing N-terminal His-tagged recombinant AGR2 whose 1-20 a.a. signal peptide was deleted. AGR2 mutants were generated from pHis-AGR2 plasmid by Mutagenesis Kit (Toyobo, Osaka, Japan) and purified as recombinant AGR2.
Primers of deletion of adhesion activity domain named as 'ADH': forward 5 0 -CCCCAGACCCTCTCCAGAGG TTGG-3 0 , reverse 5 0 -GTGGTGGTGGTGGTGGTGCATA ATC-3 0 ; primers of mutation at dimerization activity domain 60 EALYK 64 to 60 AAAAA 64 named as 'DIM': forward 5 0 -CAGCAGCTTCATATGTCTGAGTCCAGATGA G-3 0 , reverse 5 0 -CTGCTGCTTCCAAGACAAGCAACA AACCCTTGATG-3 0 ; primers of site mutation C81S in PDI activity motif CXXS named as 'PDIs': forward 5 0 -GA CTCATCCAAGTGATGAATAATCATCAAGG-3 0 , reverse 5 0 -CCCACACAGTCAAGCTTTAAAGAAAGTG-3 0 .

Zhu Q., Mangukiya H.B., Mashausi D.S., Guo H., Negi H., Merugu S.B., Wu Z, & Li D. (2017). Anterior gradient 2 is induced in cutaneous wound and promotes wound healing through its adhesion domain. The FEBS journal, 284(17).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!